Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.18
Orientation:
(-)
Number of Exons:
4
Description :
Poly [ADP-ribose] polymerase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-361
NN-scoreoddsWeighted Score
0.5871.3640.003
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
*** None ***
Sequence
        1294 bases(100 bases per row)
ATGGCTCCTCAGAACCCAACCGCAGCCGCGCAGCCAGCTAATGCGGCTGTCGCTCCAGTCGCGATCAAGAACGCGCTCGCGACGGAGGTCGAACACGCAC
CTCTCGAACACCCTGAGCTCGCTCCCGTCTTCCCGAAGGACACATACTCACCCATCCAGGAAGTGGCCTACGAAGACCGCGCGCTCAAGGCCGACCCGAC
CTTCAAGAATCTTCTCGCCGACGCGACCGTGACGCATTTGACGCCCAAGATCGGCACGGAGCTGTCGGGCATCCAGCTCCACGAGCTCACCGATGCTCAG
AAGGATGAGCTCGCTCTTCTGGTGGCGGAGCGCGGCGTCGTGTTCTTCCGCGACCAAGACATTTCGATCGACCAGCAGGTGGACTTGGGCCGTTACTACG
GTCCGCTGCATGTCCACCAGAACTTTGGTCACCCGGAAGGGTACCCGGAGGTGCACGTGGTACACAACACGGTTGAAGGGAGTAACGCCTTCTTGAAGGA
ATACCGACTCCTCGACCCGAACAACGAATGGCACAGCGATGTGACGTACGAGCGTCAGGTACGCTGCCGCTTGCTCGACGGCATGGCTTGTTTCGATTGA
GTACTAACAGCTCCGTTGATTGGCAGCCTCCGTCCTACACGACGCTGAAGGTGGTGACTGCGCCAGATTTGGGTGGTGACACGCTCTGGTCGTCGTCGTA
CGAGGCGTACGACCGCCTGACGCCATCGTTCCAGGCGTTCTTGGAGGGACTCACGGCCACTCACAGCAGCAAGGTGAGGTTTCTCGTTCGTGTGGCTTGG
TGTTTCGGTTTGTTACCGTTGCCAACATGCTTGCTGTTCACAGGAACAAGCCGAGGAAGCACTCGAACGGGGACAGACGCTGCGCCGCCCGATCGTTCAG
CACGTGCATCCGGTGGTGCGAACCCATCCAGTTACCGGCCGAAAGGCGCTGTTCGTGAACCCCGCGTTCACTCGTCGGATCATACAGCTGTCCAGCGCTG
AGTCGGGTATGTCCCTAGTCTTCTCACTGTTGGCAATGTCGACGCGCACGTATTTATGTTGTTCCTGGTGGTGTAGATGCCGTCTTGCGGTTCCTGTACA
AGCATATCGCAGAGGGTCACGAGTTCCAAGTGCGCTTCCGCTGGACGAAGGACTCGCTCGCGATCTGGGACAACCGCGTGACCAACCACTACGCCACGTT
CGACTACCTCCCAGGCAACCGCCACGCCTTGCGTGTGACACCACACGGCGAGATCCCGTACTTAACGAGCGACAGTTCAACAGCAGAGCCTTAG