Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-1.54
Orientation:
(-)
Number of Exons:
2
Description :
Dicarboxylate/amino acid:cation
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Sodium:dicarboxylate symporter1.3PR00173
Sodium:dicarboxylate symporter1.3PR00173
Sodium:dicarboxylate symporter1.3PR00173
Sodium:dicarboxylate symporter1.3PR00173
Sodium:dicarboxylate symporter1.3PR00173
Sodium:dicarboxylate symporter1.3PR00173
Sodium:dicarboxylate symporter1.3PR00173
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
85-96
157-328
384-432
501-528
1-61
120-133
352-360
456-477
62-84
97-119
134-156
329-351
361-383
433-455
478-500
NN-scoreoddsWeighted Score
0.6221.930.004
*** None ***
TypeScore
endoplasmic reticulum667
GO
Biological ProcessGO IDPrediction Method
sodium:dicarboxylate symporter activityGO:0017153IEA
membraneGO:0016020IEA
dicarboxylic acid transportGO:0006835IEA
*** None ***
*** None ***
Sequence
        1642 bases(100 bases per row)
ATGGACGACCGCACGCGCGTCATGCTGTACGCGCCGGCGGGCGAGCGAACCGCGCACGAGGACGCCGGGACGCCGACCGAGTCGCTCGACTACGCGCGCA
AGCTCGAGCGCGACTCCAAGGGCGGCGGACTCGGCACGCCGCAGCGGTTCATGCGGCATCCGGCCGCGCTGGACGCCGTGTACCCCGAGGAGCCGGNNNN
NNNNNNNNNCGCGGTGCGCGCTGCTACGGCAGCCGACGACCCAGATCCTGATCGGTGCCTTCCTGGGCGTCGTGCTCGGCGGATTGCTGTCGCGCGCAGG
CGTCTCGTCGGACGTGAGCAAGCTGGTGAACCTCCCCGGCACAGTCTTCCTGCAGGTGCTCAAGTGCTTCGTGATCCCCATGATCTTCACCAGTTTGTCC
ACGGGGGTGGCCGACATCGTGCTCATGGGGAAGGTGTCGGTGATCGGCACGCAGACGGCCGCCTACTTCCTCGGCTTCTCGCTCTTCGCGTCGATCCTCT
CGACCGCCATCGCCCTGCTGCTGCGCGGTCTGCAGTCGCACAGGATCCACGGCAGCACCGAGGAGGACGAGGCATTCCTGAGCGTGCGGTGCACCGACGG
CTCGTTCTTGTCAGCCAACTCGACCAACTCGACGACCTGTTCAGTCGACGCGGCCGGGAATGCGACGACACTGCAGCTGATCGACTTGACGGGCGTCATC
CTCGTGGATGCCACGGCCAGCGCAGCGACCTCCGTGCGCACGCAGATCAGCAACATCCTCGGCGACCTGCTGCCGAACAACATCTTCCAGAGCTTCCAGA
ATGGCACGCTGCTGAGCGTCATCACCTTCTCGCTCGTGTTCGGCGCTGCGGCCGTGAAAGTGAGTTCTCGCGAGAACAGTCCGCTGCTGGCGGTGCTCGA
TCAGATGAACCGCGTGTTCTTCCAGGTCATCCGCAAACTCATCGACTGGAGCCCGCTGTTCGTGTGCTCGCTCGTGGCGGGGTCGCTGTCGAGCCAGGAG
CTGCTCGCCGAGTCGGTGACCCACGTCGGCGTCATGGTGCTCGGCTACATGATCGCGTTTGTGCTGTTCGAGTTCGTCTTCATCCCGCTCGTGCTGTGGC
TGGCGCTCAAGAAGAGTCCGCTGCCGTTCATGAAGGCCATGATCCCGGCCGCAATGTTCGCGTTCGGCTGCTCGTCTTCGCTCGTGTCGCTCCCCGTCAA
CCTGCGCTGCGTCGAGTCGTCCAAGGAAGTCTCGCGCGGGTTATCGCACTTCATCCTGACGATCGGATGCACGGCTCACAAGAACGGCTCGGCCATCTAC
TTCCCCTCGGCCATGGTCTTCCTCGTGTCGACGGCCGACCAGGACCTCGAGCTCGGGTGGGTGCAGGTGCTGCTCATCGTGTTCGTGTCGCTGCTCGGGT
CGATCGGCGCGGCTCCCATCACCAACTCGAGCCTGGTGGTCATCTACTCGATCTGGCAGACCGTGTACCCGAACGCCCCGATGCCCGCGAGCTTCAGCTA
CCTCGTGGCCATCGCCTGGTTCGTCGGCCGCTTCACGACCGTCGCCAACGTCATCGGTGACGCCTACGTGGCGCGCATCGTGGCCGAGCAGGTCGACGAA
ACCTACGACCTGCAGCACCAGCACCAGCAGCATCATCAGTGA