Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-1.4
Orientation:
(+)
Number of Exons:
1
Description :
Major Facilitator Superfamily (MFS)
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Sugar/inositol transporter1.1PR00171
Sugar/inositol transporter1.1PR00171
Sugar/inositol transporter1.1PR00171
Sugar/inositol transporter1.1PR00171
Profile scan predictionP-Valprediction_id
Major facilitator superfamily domain25.329PS50850
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Major facilitator superfamily domainIPR020846
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
membraneGO:0016020IEA
*** None ***
*** None ***
Sequence
        1530 bases(100 bases per row)
ATGACAGTGCAAGCCGTCGAGCCGTCCACACCAGGGTACGCGATCGCCGTGTCTCCCGGCGCGCCGCGTCAGCAGCTGCTGGCCGAGGAGCGGTCGCTGA
AGCCGACGTGGGTTGTCTACGCATGCGTCTTCACCGCCATGCTCGAGGCGTTCCACTACGGTTGGTCGAGCTCGCAGATCAACTTCAGCAAGTTCAACAA
CACGGAGGAATGCAATGCGCGGCCTGTCGAAGAGGGGACGTGCCTCATGTTCCCGGGTCACACCAAGGCGACGTGGATGCTGCTCGTGAACGCGTGGATT
GTTGGCGGCATGGTCGGCAGCCTCGTGTCTGGCTCCGTCTCCAACAAGTTCGGTCGTCGCCAGGCGCTCCGCTACAACACGGTCACCATGGTGCTCGCGT
GTATCATCGAGGTGGTGGCGCCTAACGCGGCGTGGTTCACGGTCGGCCGCTTCGTCGCCGGTGTCGCCAACGGCATCGCCATGGCCGTCGTCAACGTCTA
CTTCAGCGAAATCTCGACGCCGCACAACCGTCACGCACTCGGCATCAACACGCACTTGGCCGCCACGCTCGGTATCTTCGGCGTCGCCACCACCTTCTGG
TACTGGGACACGACCGCCGGCTTCCGCTGGATCGCCGGCATGCCGATCCTGAACGCCATCGGCTTCCTGCTGCTCTCGTACACAGTGATGGTGGAGAGTC
CCGTGTGGCTCGTGACGAAGGGCAAGGAGGCTGAGGCTGAGAAGGAGCTCGCGCGTCTCTACGGCAAGCACAACGTCGAGTCGTTGATGAGCTGGATCCA
GGCCAACGACCGCCGCTCCAAGCTCCCGTCGACGGTCAGCGGAGGCGACGCGACCGAGGTGGCGTCCGACAGCGTGTGGACCATCCTGACGTCGTCCAAA
TTCCGTCGCCAGGTGCTCATCGCGTTCGGTCTCACGTGCGTCAACCAGCTCGTGGGTATCAACGCCGTCTTCTTCTACTCGTCGTCCATCATGAAGAGCG
CGGGACTGACCGACACGCGCGCCGGTCTCATGATCATCGACATCCTCAACGTCATCCCCGTCCCCATCGCGTCCATGCTCTCCAAGACGCTGCGCAAGCG
CACGATGCTGCTCTCGGGTATCTTCGTCATGGTTCTCTGCGCGCTCGGCATGACCTTCTCGCTCATCTACGACATCGGCTGGCTCTCCATCGTCTTCCTC
GGCGTCTTCGTCGTCGGCTACGACCTGAGCATCGGTCCGCTTCTCTGGCCCATGATCGGCGAGCTCTTCCCGGACTCGGCGCGCGGCAACGCCGTCGGAC
TCTGCGTCATGCTCAAGTGGTTCTGCGCGCTCATCATCGGCATCGGCTTCCCGTACCTGCAGGAGGCCATCACCGACTACTCGTTCACTCCGTTCCTCGC
CACGTGCTCGCTCTCGCTCGTCTTCATCTACTTCATTGTGCCGGAGACGTCCGACCTGACGATCGCCGAGATCCAGAACGGCTTCCAGGGCCGCGGCAGC
GTCGAGGCGAGCGCCAAGAGCCAGCAGTAG