Transcript Name :
Pytve_DAOMBR484fgenesh_masked-pve_contig_1-abinit-gene-0.127
Orientation:
(-)
Number of Exons:
2
Description :
40S ribosomal protein S15a
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-130
*** None ***
PositionContextScore
23AEKRGKR|QV0.506
*** None ***
GO
*** None ***
KO ID
K02957
*** None ***
Sequence
        462 bases(100 bases per row)
ATGGTTCGCATGAGCGTGCTGTCCGACTGTCTTAAGACGATCTACAACGCCGAGAAGCGCGGCAAGCGCCAGGTGCTGATCCGCCCTTCGTCGAAGGTGA
TCGTCAAGTTCCTGCAGGTGATGCAGAAGAACGGTGCGTTCGCGTTTGACGCTCGTGTCGGTGTCGCGAGGGAGAGATTTCTGACTCTGTACCTTGGAAC
AGGCTACATTGGCGAGTTCGAGATCGTTGACGACCACCGCGCCGGCAAGATCGTGGTGGAGCTGAAGGGCCGCATCAACAAGTGCGGTGTGATCTCGCCG
CGCTTCGACATCAAGCTGCAGGACTACGAGAAGTGGATCAACAACCTGCTGCCGTCGCGCCAGTTCGGCCACATCGTGGTGAGCACCACGTTCGGCATCA
TGGACCACCACGAGGCCCGCCGAAAGCACACGGGTGGCAAGATCATCGGCTTCTTCTACTAA