Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.14
Orientation:
(+)
Number of Exons:
1
Description :
Inositol-3,4-bisphosphate 4-phosphatase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pleckstrin homology domain14.164PS50003
HmmSmart predictionP-Valprediction_id
Pleckstrin homology domain2.4SM00233
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pleckstrin homology domainIPR001849
*** None ***
InsideOutsideTMhelix
1-1267
*** None ***
*** None ***
TypeScore
nuclear739
GO
*** None ***
KO ID
K01109
K01109
Cluster Id
4906
Sequence
        3804 bases(100 bases per row)
ATGCAGACCGCGCGACCGACACTGGCATCGGCGGGTAGAGGCGGGCGAGAGCTGGTGCCGTCGCGCCACGCGCCAACCCCTGAGCCAGCCTCGCCCTCGT
TCTCAGCGGAGGCGGCGACAGCAACAACAACAGCAGCAAAGCCCGCGCCGGCTCCTGTGCGCGCCGCGAGTCTCCGTGAAAAGCCCGCGGGTCGAGCCAG
GAAGGGCAGCAATGCGCCTCCGTCGCGAGCGGCCAGCACGTCGGGCAAGGGTTCGAAGCCTGCTGCGGCCAAGTCGACCGCGGAGGGAAAGTCGAAAGCG
ACGACTTCAACGTCAGGGACAGCGTCATCGGCGACTCCCGCGACGACAAAGGCGGCTACAACAGCGACGGCGAGTGCCAAAGAGGGGACTACAGTGGCTG
CCAATAAGGATGCGTCGACAGCGGAGCCGCAGCAACGCGAGATGCGGCTGGACGATGCGGCGGCGGTGATGGGTCGGAACCGCGGACCTTCGACAGCCGA
CGGACCCGGTCAAGAGGTGAAGCCGCGACTGCGCGTGTCGGAGAGCGGCAAGTTCGAGGATCAATTCTACCACGCGCATGAGGGCTCGCGCGCCATAGGT
CGGCTGCGCAACCGCGCGTACCTGAAGAAGGGCGACAAGAAGGACTCTGGAAAGGCGAAGAAGAACGCCAACGTGAACGCCAGGGACGTGGATCTGTTCT
CGGACGCCGACATTGTGCAGAGCGGCTACCTTGTCAAGCAGGGTTCGTTCTGGAAGACGTGGCGCCGTCGGTACTTTGTGCTTCGGCGCGATCTTCCCGT
CATGTCGTACTTCAGCTCCAAGGACGACCTGATGAAGCTTGGAGAGATTGCGATCGACGAGTCGACGACTGTCGAACCCGCGCCGAAAGACGGGTTCCCG
AATCGGTTCATTGTGGAGCATAAGGGTCGGAAACTGGTTCTGCTCGCCGAGACGACTGAGAACGAGAGCATGGAGTCGTGGGTCAAGTGCATCGGGAGCT
GCATCGAGTTCCGCAAGACTCTGGCCAAGCGCGCGAGTGGGTCGTTCGACAACCGTCGGTCTGGCGGAAGCGGCGACTCGTTCCGTTCACAGATGCGGCT
CTCTGAGAACGCGTCCATGGTTGAGGAGCTGCTGAACGATCGCGCTAGCATCCCGCGGATGGAAAACTCTCGTCAGCCGAACTCCATGAAGCGGTACACG
ACCGATTCGGTGGCGATTCAGAAAGCTGCTGCTGAAGCTACTGCAGAGCGGGAAGCTGAAGGTCGGCAATCTCAAGCGCGTCGAAGCTCTCGACTCCCGA
GCGTGCTGTCGGCTCCCTTGGACGAAGAGGACAACCAGCGACCTCGAAGGCTGTATCGGTCACGCAGCGCTGGCAGTGTCCTGTCTCGACTCTCGATGGA
AAAGGCATATCAAAAAGCAGCGCTAAAAAACCATGACGACAATGGGGTGTCGACGCTGTTGCTGGCGAACCACCCAGCCGATAACACCCAGAGCCTGAAG
CTGGCGCCAACGGAGCGGCCAGGAATCTCACAGCTGACGCGCGCGCCGAGTCTGAGTCTTCCTGGGTTCAAGCCGCCGTCCAGCATTGAGCTCGCTGTGT
CGATCGGAAGCAAGGGTGCGCAGGAGAACTCGCACATGATGGTCATCCTGTCATCCGTCGCTCAAGGCGGCCGTCAAGAGGAGATCTGTCGAACGGAGAT
GAAGAGTTCTCTTTCGCTGCGCTCCTGTGGCGGCGACTTCTACGCGCGCGACTTCAGTGTCTTGCTCTCGGTGCCTCGAAACGCCAAGAGCATGCTACAT
TTCGAGCTCTTTTCTCTGGCAAACCCGAACTCGGAGTCTCTCGCTGGCCAGAAGCCGTTGGGCTTCGTCCGCATCTCGCCTCTGGACTTGCTGTTCTCTC
GCGACTCGACGATTGTGCTGGAGTGTCACGGATCGAAGAACCCGTTGTTGTTCCTGATCCTTGAACGGATCTTGCCTGGCGAAAGCATCAATATCGGTCA
CGCGTACACGTATGCAAAGCGGTGTTTCATCGCGGACACGGCTGTGATGGAGAAGCGCAAGTCGGGTGACCTGGTGTCGGCTGCGTCGGTTCCTGCCAGT
TTGGGCCAGAGCTATCGCGACATGATGCGCGGCAAGACGAACTCTATCGATGCCAATCACGTGCTGGTTGCTGAAGAGCTCTCGTCGTCGTACATCTCGG
TGTCCATGACTGTGGCGTTCTTGAACTTCCTGCAGCGACGCAACCTGGATCGCATCGAGAACGCCAAGAAGCAGATCGAGGAGTTCAGGAAGGAGTTCAA
GGATCGATCTCCGACGAACGCTGCGCATCCGATCCGTCCGTCGGGCCTCGACCCTGACAGTGTGCGCGATTTGGAACTGGAGATGGCACATTACATGCGG
TTGCACGCGGCGTATCTGGAGAACCAGAAGCGCTACCAGTCGGTGCTGCTTGCGCTTGAAGAAGGCAGAGAGCAGGGGATCACGGGGAGTTTGAAGCGCA
GCAACATGAAGAAAGACAAGTTTACGGAGTTTATGCCGACGAACTTGAATTGCCACTTGGTGCGTGCGCGTCGGATCGCTCTTTCGAATGGGGAGCGGCG
AAGCTCTGTAACGCGATCGTTCGAGGAATCGGACTCGGACAGTGAGATCGGGGCTGCGTCTTCTGAGCTAGTGTACGAGGTGACGACTCACGGATGCGCG
GCGGCCCACGTGCTCGGATTCAAGGAAGGTGGTCTGCGCCGATTGCAGCACCAGCTGACGCAGACGCCGAACGACGGACGACTGCGCGAGCGCATCGAGC
AGCGAGAGGATGTCGTGCGGTCGCAAGTGCTTGCCATCGCCGGCGCGGCGTTCCTGAGCGCTGTCGGGCTGGCAGCCAGCAAGGGAGGCAGCCACTACGA
TCGCCTCAACCTCATTTGCTCGACGGGGTTTTTAGTCAGTATCGAATCGCTGCTGAGCACGGTTGGCGCGGAGAAGGGTATGCTGGAGGACATGTCGGAC
GGCATCAAGTGGCTGAACCGATCGGTGAACTTCCAAGTGTTGCAATCGATCGAGGCGCACCCGAGACTCAAGTACTCCAAGTGCGTGAGCATTCTGAGCA
CGCCGACAGGCGATCACATCGATGTGGCATTCGCCGTCCCGACGGACGTGTTCAAGAAATTGCCAGTCATACTGCAAGAGGGCCACGCCATCAAGGTGCA
CGCCGTCATGTTCACCCAAGGCATCAACGAGATGCAATCGGTGGCCAACCACTACCTCAACTCGAGTCTCCAGGACGAGCTGAACTCGGAGAACGCCGAC
ATGCTGGAGCGGTACTTCCGCGTGTACCAGACCCAGGTCAAGTTTTTGAGCGACCAGAACGCGAACCAGTCGAGCCACCGAGAGCGCGACAGGTTGACTG
CAACTGTTGGCGATCTGAACGAGTTGCAACGAGAGATCCAGTCGCTGCGGGAACGACTGAGCACGCGGACCGAGAATGTCCAGAAGAAGTACGTCAATAT
TCTGATCGAGTCGAGCGACATTTGCCGACGGCTCGGCGCGGGTCGGACCACTTGTTGCAAGAGCGGGAAGGATCGCACGGCCATGTCGGTGACGCTGGAG
ACCTCTCGCGTGCTCGTGGACTACTTCCACGTGAAGCAGGGAGTGCATCTGTGCAACGCCATGCGCGAGCGAGGCGTCCGACGCGTCAACGTGCTGGCCA
ACACGGGCAAGGACAAGTACGCGTTCAACAGCTTCCAGCTCATGTACATTCCTGACTGCTACAAGCCGCCCGTCGCCTCGGCCGACTCGCACGTGGCGTC
ATGA