Transcript Name :
Pytve_DAOMBR484snap_masked-pve_contig_1-abinit-gene-1.66
Orientation:
(+)
Number of Exons:
2
Description :
Myb-like DNA-binding protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Myb domain14.845PS51294
Myb domain23.336PS51294
Myb domain12.901PS51294
HmmSmart predictionP-Valprediction_id
SANT/Myb domain1SM00717
SANT/Myb domain1.9SM00717
SANT/Myb domain3.2SM00717
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Myb domainIPR017930
*** None ***
InsideOutsideTMhelix
1-229
NN-scoreoddsWeighted Score
0.9216.2520.013
*** None ***
TypeScore
mitochondrial435
GO
Biological ProcessGO IDPrediction Method
chromatin bindingGO:0003682IEA
*** None ***
*** None ***
Sequence
        701 bases(100 bases per row)
ATGGCCGTACATTCGAGGTATTGGACCGTGGGGCGGCCGCGAGGAAGGCAGCCCCCCGTCGATGGACCCGTGAAGAGGACGAAGCCCTAAGGTCCGCAGT
CGAGAGCCACCGTGAGAAGAACTGGAAGGCGATCGCAGCTCTCGTCCCCGGTCGTAACCATACCCAATGCCTCCAACGATGGACCAAGGTGTTGGCTCCC
GGCCTTGTCAAGGGCCACTGGTCCCCACATGAAGACGAACTACTGCGGCGGCTTGTGGCGGCCGAACAGAAGAACTGGGGAGAAGTAGCAGCGCAGATCC
CAGGCCGAACGTCCAAGCAGTGCCGAGAGCGGTGGCACAACCACCTAGACCCCAACATCGTACGCGGAGCGTACTCCCCAGAGGAAGACCGCATCATCCT
TGAGGCCCAGGCGAGGCTCGGGAACCGATGGTCGGTCATCGCGGCCATGCTGCCCGGAAGAACGGAGGACGCAGTCAAGATCCGCTGGAAGTCGCATTGC
CGCGTCTGGCGAGCGCGAAAGTACCTGCGCAAGGCCCCAAGTGGTCAGGCGGGGGACGTGGGGGACGAAGACGGACGGGGAGGTAGTGACGACGAGTGGA
GCGAGCCACCGACACCGCAGACGCCGCTGGTAGGCCCAGGGTTCGCGTGGCCGATGGCCCTGCCATCCCCCACGGCGACGGCGGCACCCGCGGCCGACTA
G