Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-1.28
Orientation:
(+)
Number of Exons:
4
Description :
Cryptochrome
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
DNA photolyase, N-terminal28.091PS51645
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
DNA photolyase, N-terminalIPR006050
*** None ***
InsideOutsideTMhelix
1-655
*** None ***
*** None ***
TypeScore
cytoplasmic565
GO
*** None ***
KO ID
K02295
*** None ***
Sequence
        2256 bases(100 bases per row)
ATGGAACGGGACGCCCCGCGCCGCGATGAAGGCCCGCCGGCCGCCCCCGCAGCCTCAGGCTCTACGACAACCACAGCCACCGCGACAATCGCAGTGGAGG
AAGACCAGGGCGAGCTGCTGGACCTCGAGTCGTTCGCGTCGGCGCTGCTGGATGAGGGTCCCGGCCCCGGCGTGGACGCCGATGTGGGCAGTCCCGAGCT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNACGACATCGACCCGGTGATCCACTACCAGATCGCGTCGCCGCCGCCGGACGAGGAGGACGCGCAGCGGGAGC
CGCGCGTGGCGCCGGAGGAGCAGGAGGAGCAGGTCGAGGCCACAGCGAGCAAGGACGAGGACGAGGACAAGCAGCTGCCGCAGCCGCAGGAGGACGAGAG
CGACCGGCCGATGCGCGCGCTGCTGTGGTTCCGCCGCGACCTGCGCGTGCACGACAACCTGGCACTGCACGCGGCGCTGCGGCAGCTCGAGGCGCACCCG
TGCGCGGACAAGAGCGAGCTCATCTCGCTGTACACGGCCAAGCGGCCGCAAATCATGCTGTGCGCCGCCAACCGCTTCCAGTTCATGCTCGAGAGCGTCG
CGGGCGTGATGGAGGCGTTCGAGGCGCGCGGCTCGCGGCTGCTGGTCGCGCGCGGCGACGGCGAGCAGGTGCTGCGCCGCGTGCTGCCCGCCTGGGGGAT
CACGCACCTCTTCTTCGACGCCGCCAGCGAGCCGTTCGCGCTCGCGCGCGATGACCGCGTCGTCGACATGGCGCAGCGGCTCGGCGTGCGCGTCGAGGTC
TCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTACGACCTCAACGCCGTGCTCGCGTGCAACCACGGCAAGCCGCCCAAGAC
GTACACGGCGTTCCTGCGCACGCTGGCGCTGTTCCCGCCGCCGGCCAAGCCTTTGCCCGTGCCGGAGACGCTGCCGCCGCTCGCGCAGTCCCCGCAGGAA
CTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGAGGTGGTGGACTACTGGTCGCAGTCGCCGAACAACCCAGAGAACGATGTGGACAA
TGACGAGGACGACCCGACAGCACTAATCGAGACGCTCGCGGGTCCAGACAAGACGTTCGGATTGCCGCAGCTGACCGAGTTCGGCTACGAGCCGCAGCAG
CGACACCCGTTCCTGTACGGCGGCGAGCAGCGCGCGCTCCGCATCCTGGACGCATACTGCGCGAGCGAGGCGCGCGTCGTGCGGTTCGAGAAGCCCAAGA
CGTCGCCGGCCGAGACGCAGCCGTCGGCGTCCACGACGTCGCTCAGCCCGTTCCTGTACTTTGGCTGTCTGAGCGCGCGCGAGTTCTACTACCGCGTGCG
GGAGATCCAGTCGCGGCACGTTGGCGCGGCGTCGGCTCCACCCGTGAGTCTGGACGGACAACTGCTGTGGCGCGAGTTCTTCCACTGCCAGGGCCGAGCC
AACCTGTACTTTGACAAGATGGAGGAGAACCCGATCTGTCTGCAGATCGACTGGCGGTGGCACGACATCCCGAAGCGCGAGGAGGACATGACGGTGGACG
ACAAGCTGGCCAAGTCGCAGTTCGAGGCGTGGAGGGATGGCCAGACGGGCTTCCCGTGGATCGACGCCATCATGGTGCAGCTGCGCGAGGAAGGCTGGAT
GCACCACCTGGCGCGCCACTCGGTCGCGTGCTTCCTGACGCGCGGTGACCTGTACATCTCGTGGGTGCGCGGGCTCGAGGTCTTCCAGGAGCGGCTGATA
GACCACGACTGGAACATCAACGCCGGCAACTGGCTCTGGCTCAGCAGCAGCGCCTTCTTCACGGCCTACTTCCGCGTCTACTCGCCCTCGACGTTCGGCC
GCAAGTGGGATCCGGACGGCAACTTCATCCGCAAGTACGTGCCGGTGCTGGCCAATATGCCGGCCAAGTACATCTACGAGCCGTGGAAGGCTCCCGTGGC
GGTGCAGCGCACTGCCGGCTGCCTCGTGGGGAAGCACTACCCGTTCCCGATCGTGGACCACAAGATCGCGCTGCGTCGCTGCATCGGCGGGATGAAGGCG
TCGTACGCCGCCAACAAATACGGCGAGCTGCCGACGAACCCGACTGAGGGCGATCCGGGCAGTCCGCGGACCAAGCGTCCGCGCGAGAACTCGGGCTCGT
CCGAAGGCTCGGAGAGCGCCGGCGGCAGTGTCGGCGGCAGCGCCAGCAACGAGTGA