Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-0.59
Orientation:
(-)
Number of Exons:
4
Description :
Cyclic nucleotide-binding domain containing protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Cyclic nucleotide-binding domain5PS51257
Cyclic nucleotide-binding domain11.456PS50042
Cyclic nucleotide-binding domain23.348PS50042
Cyclic nucleotide-binding domain8.061PS50042
HmmSmart predictionP-Valprediction_id
Cyclic nucleotide-binding domain3.6SM00100
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclic nucleotide-binding domainIPR000595
*** None ***
InsideOutsideTMhelix
1-949
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3028 bases(100 bases per row)
ATGCGTGAAGGGGACAGCCAACCTACGTTGTTTCACCTCGCGACTCTGTCGTGTGGAGATACTTTCGGCGAACGAGCGCTGCTGTCGGCTCTGGATGTTC
GCTCAGGTGCGTCCTCCTTCCGATCTAACGCAAGCGAACATCGACATATATACTCAAGTGTTGTTTGATACTGCTTCAAAAAAGCATCGGTACTGGTTTC
GGTCGCCCCGGCAGAGCTAGTTTTCGTTAACCGCACCGTGTTCAAGGACTTAGTGAATGAGTCTCACGACGAAGCCGCCAGTGCGCTGGAGATCTCGAAG
CGCTTTCGCTCCAACAAGGATATTGTGCGAAACATCTTCCTTCGTAATCCCGCCCAGCGCTCCGAAAAGGACCTCAAGTTCGCGGTCGAGTATCTGAAAA
GCGTCAAGTTCTTCTCGCGGTTCTCCTTCGAAGTTCGCAAGCAGCTGTGCAAGGTGATGCGTCTCATCAGCGCCATGACCAACACGGTGCTGTTCGAGGA
GGGCCAGATTGGTCGCCACTTTTATATCATCTTCACGGGATGTGTCGAAGTCTCGGTGCAGGTGAAAAATCGGTTTGAGGAAACCAGTGGGAGTGTGCTC
TCTCGGCTGGAAGAAGGGGACTACTTTGGTGAATTGGCTCTGTCGGAAGCGGAGGGGGTTCGCCGCGCTACAGTGACGTGCACCGATTTCTGTGAGCTCC
TGGTGCTTGGTCGTGAGCAATACGAGCCACTTATCCAGAAGTACCAGAACGAATATCACGCGCAGTACGCTCAGATGCTACGGAAGAATCTGTACTTTGT
TGGCCCCGAATGGGACGACAACACGATCGAGGGTATGTGTTCTGTCATGACAGAGAAGTACTTTCCCTTTCGTGGCGAGATTTGCAAACAGGTGCAGTTA
TTTGCTCATCCGGTGTGTCTGCCAGCAACGAGACTAATGTGTTGCTCGTTTGCCGCATCTACTGCAAAAAGGGATCCAGAGCGTCGGAGCTCTTTATTGT
GGCAAGAGGAGAGTGCCGAGTCGTTCATGAGGGAAAGCATCCAATAACAAATGCTGTGCAAATGTACGAACTTGGACGCTTCGGCCCAAACTCGGTTTTG
GGCTGTGCAGAGTAAGTGGATCGAGGCCGAGTCAGTGCAAAGCTCTGTTTCTAGAGGTATAATTGTGCGGTGTAAAATGTTTCAGGGCCTCTGCTGGCAA
GTTCACGGACATTGTGGTTCGTGACTACTCTATTTACGCCGAGTCTCCGATGAAGATTTTGATTCTGTCACGCTTCGACATATTCCACTTGATGTCTCCT
GAAGCCCGCGCCAGCCTTCAGCGATCGTCTCTGGGAAACATTCGCGAGTCGATCGAGAGCCGAGCGCTGAAGTCGATGGCGTGGGAGAAGTATAAGAAAC
GATTCTTTGACGACCTTGTGGTTCCCAACAACGCCACGCACGGCCAGGGTCCCCGATCCCCGAGCAGGGTGCTTCCACCACCAATGGATCTGGGAAAGTC
TCAATCGACACCGGTGCTGTCGACGACCACGACAGCCCAGACTCTCGTCGACCCTGGGACGCTGGTGCTAGTTAATCGTCGAGAACTACAACTCTACAGT
ACCAGCAATGTCTCAAGTCCGAACAAGAAGCAAAGTCAAAGGCATTCGTCACCGAACAAAAACGACAAGGAGTCTCCAAGTTCGCCGATCGTTGAGAACA
GCCAAGAGCTTGCAGATACAGGCCATGAGACTGGGGATACTTCACGTTCGCACGGTCTTCAAGGAGCCTCCAATAGCCAAGCGTTGGCGCGAAGTGCATC
CGTGTCAGCACTCGACGAGATCACGAAGCTGCCACAGTTGACCGATGACAATGTCGCTTGTCAGCTCGAAGATTCACAACAGCCTGACGAGGTACGGTTA
GGGTCGCCGGCGTCCAATGATCGAACCAAGTCGATTCAGCGTCGATCTAGTTCGGATGTCGGGCCTCAATCGGTGCATTTGGCTGCAACAGCAACTCTGG
CTGGTCAATTACCGGCTGTAATATCGCCAACTGCAAAGACGCCGCCATCGCGTGGGCTCCGTCATGGTCCAGGCAGTCGCTCAAGGCATGAAAGACACGA
TAATGCGACCCCTTCAGCTCTTACCTCAACGATTAGAGAGGCAACGATCTGGGATCCGGTGCACGGTGTGTGCCAACCGTTTGCAGTTGTTGGGTTTCTC
AAAGAGGCTCTGAGCCGAGGACCGTCGCTATCCTCGACGGAGCTAAAACTGCCAAAGACCACAAAATCTGGCGCCACAAACTCAGCGAATGTGTCGCTGC
CTGTGACACCTGCGAATTTGCCTGGTTCTTCGCAGAGTGTGTTCGAGATCACTCACTTCCGCGTGCTTGGAAAGTTTCGCGACGTGAACGAAGCGATGGA
GCTATTTCACCGCATCTGTACTGTTGAAACCCGCACAGTCACCAACGAGGGAGCCGACAGGAGCCGCTTCGCCATCTATAAAGAAGCAGACGTCACTATG
GTACTCGAGAACTTCTCGAGTGTCGAGGCTCCACCTGATGATCCTCAGCGACAATTCGGCTCGAATGATTTGCGCCAGGCGAATGGCCAACGCTACGCCT
GTGTGGGGGTCACAACTGCAGGAGGTGCAGGCGCTGTCCCGCTCACGGTCATTGAGGCTGTCACTGTTCTGGTCTTTCAGTGTTTCCCAACCCCGCAGAG
CGCCATCCGGTTTGCGAGACAGATGTCGGCGCAGTTCATGTCGGCATCGTCGTTGTACATTGTCCCGCTGTTCGAATGGGTCCCGTTGGCCGATCTCGAA
CAGTTCGACGCGCGAAACACGGACCTGGAGCAGGCGCTCGAACATGTAATGCTGCACCGCGGCGGCGCGACGTACACGAGCACATGGAAAGCGCGCAAAG
ATGCGGTCAAGCGCACCGGTGGCCACCACCAGCACCGCAGTCGCCAAGGCAACGATCGGACATTACCAGGAGCACTCCCCCATCAGACAGCATTAAAACC
GGCCTCGGCACCATCGCCGGTGCTGTAA