Transcript Name :
Pytve_DAOMBR484snap_masked-pve_contig_1-abinit-gene-0.116
Orientation:
(+)
Number of Exons:
12
Description :
HIR histone cell cycle regulation defective homolog A
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
G-protein beta WD-40 repeat8.9PR00320
G-protein beta WD-40 repeat8.9PR00320
G-protein beta WD-40 repeat8.9PR00320
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain25.997PS50294
WD40 repeat11.177PS50082
WD40 repeat14.519PS50082
WD40 repeat14.886PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat9.1SM00320
WD40 repeat4.5SM00320
WD40 repeat9.8SM00320
WD40 repeat11SM00320
WD40 repeat0.017SM00320
WD40 repeat200SM00320
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
G-protein beta WD-40 repeatIPR020472
*** None ***
InsideOutsideTMhelix
1-768
NN-scoreoddsWeighted Score
0.5721.450.003
*** None ***
TypeScore
cytoplasmic435
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
1911
Sequence
        3204 bases(100 bases per row)
ATGCTGCTGGAGAAGCCGGAGGACGTCCGGCACGAGAACGGCTCGGGGACAGGTGCGCTGTCGTACCTAGGCGTAGCGGTTTCTTGACAGAGGCGCAGCT
TAATCTTTGGCAAGTCGCTAATCTCGACATTCCCACACAGCCTGTGCGATATATGGCATTGACGCTCACCCGACGAAGCAGATCTTTGCTACGGCTGGAG
GAGGTACGTTCCGCTGTGCACGGCTTGCTGAAAGCCGCCGCTAATAGCCTCGATGGCGACGGCACAGATAACACGGTCAAGATCTGGTCGCTCGAGCCGG
CGGGGGATGAGAACGTGGCGACGTTCGAGCTGCTCGCGACGCTCGCGTTTCACCAGCAAGCAGTCAACTGCGTCCGATGGGCGGGTCACGGACGCTATCT
GGCGTCTGGATCGGACGACCAGTTGGTGCAGCTGTACGAGCTGCAGTCCGGTGCTCCACCACCGGTGCCGTTCGGGTCGAACGCAAAGCCAAACAAGCAG
AACTGGGGACGTTGCGCCACGCTGAAGCGGCATACTATGGGTACGCGCAGATTGGTGGTGGCGGGGGTGTCCACTTGGTTAGCGTGCCTGACTTTGCACT
TTTGCAATGAAAAGATGTTCAGGATGTGGCCTGGTCGCCGGATGATCGCATGCTGGCGACGTGCAGCATCGACAACACCATCTTGATCTGGGACGTTGGT
GTGGCGGGGATTAGCGAAGTCATGACTCAACCATTGCACACTCTCACTGGTCACAATGGATGGGTGAAGGGTGTGGCATGGGACCCGGTCGGAAAGGTAA
TGCCGCGCGCCAATGTGCGAATGCTGCCTTTATTGATGGCACCAACCTCGTGCTCTTGTTATCACAGTATCTGTCGAGTGCCGGGGAGGACAAAACGGTT
CGGATGTGGAAAGTGGAGGACTGGCAGGTAGGCGTCGTGGTTCTGGTGATAAGAGGGGGTGTTGACCACTGCTTGACGTTGACATTTGGTATGGACATAC
TGGGTTGCAGATGGCGGATGTTGTGACTGAGCCGTTCCAAGCTTGTGCCTCAAAATCCAACTTCCGACGGCTCTCGTGGTCGCCTGATGGCTCTGTTCTG
TGCGCTACGCATGCGTTCAAGTCCAAGAAGAACATCGCGGCTCTGCTCAAGCGCTCCGACTGGACAGATGACCTCAAGTTTGTCGGCCACCAGGGCGTGG
TCACCTGTGCTCGATTCAACCCGAAGCTGCTCGGTAAAATATGCTCCTGCACTTGTGCGTGTGTCTGATCTTGCGCTCACACTAACACCAACCTGCTCGC
TATAGTTGCGGCCGACGAGTCTGAAACCGAGTACGCCTGCTGCGCAGTTGGCGGAGAAGACGCTACCGTCAGTATATGGCTGGCACATCTCGCTCGACCG
CTCGCCGTGATCAAAAACTGTTTCAACGCGCCTGTGACCGATTTGTCGTGGTCTACCAATGCGGCGCTGCTTCTTGCGTGCTCGCTGGATGGATCACTGT
GCTGTTTCCAATTTGACGACGGCGAGATCGGCACTCCCATTTCTGATGCCGATCAGAGCAAGCTGTTACAAGCAAAGGTAAGCAAGACAATGGATGCATT
TCAGGCTATCGAACGTTGCATACTAATGTATCGCAATATGCGTACTGCTGAGTAGTACGGATCGCGTGCTGGAATCACCCTTGCGTCGACGCTGGCAGAA
AACCCGATCCAGTTGCAGGTAATGTATGCTGCAGGTGAACATTGTGGTTGCTGGAGTGACTCACAGGACGTTCGATGCAGCTCGAGGAAACTTCGTCAGG
TCCAAAGAAGACGGTGGTCAGTTCCAACCCCGCTGGTCCTGTTGCCCCAGTTGCCCCGCCTGGCCAAACAACCATGCTCGTCCCGAGGAAGAAGAACACT
GCTCCAACTGACTCATCAGCGAGCAATCCGCGGACTACCTCGAAGGCCAAGAACGATAAGAAGCGTATTTCTCCGCTCACTGTCCAGACTGCTCCGATTG
ACTCCGAGCCGGCCAATCGAGCATTCAAGCAAAACAACATCCAGAACATTTTGGCTCCGATGCCACCGACTCCGACTGCAGCCGATGCAAACCTGATGGC
TGCTCGCCTGGACAAACCTTTGAATCAACGGAGCTCGGGCAATGAAGAGCTCGCTCAGAGTGTCCCTGTGCGCCACAAGAACGCGCCTGGCGGAAAGAGT
GCACCAGTCACTGTGGACAAGGCTCATCGAGAAAACGGGTTACCTGGGAAGGCTGACACGAAGAAGGCCATGGTTGACACGGTGTCACTGAAGCGTAAAC
GCGACAACGCTGCTTCGGCCGCACCCGTGGCAGTCACGAAATCGAGAGAAGTTACGCCACACCCACCCAAGTCTTTGAACGACAGGTACGTTAGTTGATA
GCGCTTTCTGAGGACTTTGATCGGGATCTTACACACTGCTAATGTGTTGCTCGCAGGCATGTCGATGGCTGGACGGCTAGTGAGCCGCTGTTGCCCACAT
TCCCGTTTCGCCTTCAGTTTGTTGTGGAACTCGGAACCGACCACGCTCAGAACCAACACGTTTCCCGAAAGCGAACGCCAGCAACGATCGCGGTCCCTGC
TGTATCCATAGAAGTATCGGTTCATAATGTGAAGAACCCTCAGACCGACGAGATTATAGGTACGTATCCCATTGATCTGTCTGGATATATCAACAGGAAC
TAAGAGTGCGTTGTGCAGAGCTTGGACCAGTGTATTCCACGGTCACATGCACCGAAGGCAACACTGTCAAGTGGATCGATCGTCTCGCAGGCCGCGTTGT
ATGTGCCGCTGGAAACGCCGTGTTTTGCGCGGTTGGTGTCGACAATGGGGATCTGTACATATTGAGCATCACGGGCCGGCGGCTGTTCCCTTGCATCGGT
ACGCTGTAACTCTGTGGTGTCAGGAGTGACCGTACTGACCTTTGTATTCGCTGTTGTGTTGTAGCACTCGGCAGCCCGATCTCTGTGATTGAGTGCAGCA
CCGGCCGGTCCCCGTATCTGTTGGTGATCCTCGTTTCTGGCGCGGTGAAGATCTGGCATGTTGACATGCGAAAGCTGACTCTGGCGGACACCATCGAGAC
TATCACACAGGTACGATTGAGCGAACTAGTACAGCTGTGGCCATGCACGGATTGCTGACAAGGATGGTGTGCGTAGACGACGTCGGCAGCGTACCCTCGT
TTGA