Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-1.21
Orientation:
(-)
Number of Exons:
3
Description :
Transcription factor protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Zinc finger, CCCH-type1PR00886
Zinc finger, CCCH-type1PR00886
Zinc finger, CCCH-type1PR00886
Profile scan predictionP-Valprediction_id
Zinc finger, CCCH-type8.305PS50103
Zinc finger, CCCH-type10.925PS50103
High mobility group box domain19.357PS50118
High mobility group box domain15.079PS50118
HmmSmart predictionP-Valprediction_id
High mobility group box domain3.3SM00398
High mobility group box domain3.6SM00398
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
High mobility group box domainIPR009071
*** None ***
InsideOutsideTMhelix
1-631
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        2042 bases(100 bases per row)
ATGGCGGATACCACCAGCGCGAGTGAGCCCGCTCCGGCGGCGGCAACGCAGCAGCAGCAGCAGCAGCAGCAGGTAGCGACCGAGACGGTGAATGCAGACA
CCGAGCAGACCGTGAAGACGGAGACGGCGGAGGTCAAGCACGGCGCGAGGAAAGGCGGCAAGAAGGAGAGCAAGGAGGACGGCGATTCGTCCAAGCCGGC
CCACTTCGAAGACAGCGAGGGCCTCTTCAAGCTCGTGTGCCGCACCTTCATGAAGCACAAGTGCAGGCGCAACCCGTGCAAGAACGTGCATGACCCGCGA
CTGTGTCCTGAGTACTGGAAGTCCGGCGAGTGCAAGTACGGCGACGAGTGCCGGCGGAACCACTTTGTGACGCTGCCGACGGCGCAGGACGCGGGCGACG
CCAGTGCGGACGCCAAGCCGGCGAAGGCGAAGAAGGAGAAGAAGGCGAAGAAGCCGTCGGAGGCCGCGATCGCGCAGCCGGCGGACGAGTACGGCGACTC
GACCACGGACTCGAAGAAGAAGTCCAAGAAGCCGAAGAAGAAGAACACGGAGGTGTGGGACCCGATGACGAAACCCGTGGACCTCCGCATCACGTACGAT
CTGGGCTCCAAGAACGACACGTTCACGACGCCGCTGGCCACGCGCGACGTCGTGCTGGTGCCGAACCTCTTCAGCGACTACAAGACTGGCGAGCTGTACA
CCAAGCTGGTGACGGAACTCGAGGGGTGCGGCATCCCGCGCGACAACCTGCTGAAGATGTGGCACGGCAACGACAAGATTGACGGCACGCACCTGATCGT
GGACGACCGGTCGAGCTGGAAGAAGAAGTGTCCGACGTTCGACCTCGTGACGGACCGCATCAAGAAGTTCTTCAAGCTGTCGATCCAGGCCACGCGCTTC
AACTGGTACCTGGACACGTCTCAATGGAAGCCGTTCCACTTCGACGCGGCTGCCGTGAAGCCGGAGATCGCTGCCAAGCAGAACTTCACCGTGGCCATTT
CGTTCGGCGCCACCCGCGATGCCGCGTTCGAGCACGCGCAGAGCAAGACGACGGTCAGCATGCCGCAGCCGGACGGCTGTGCGTACGCGTTTGCGCGCGA
CACGAACGTCATTTGGCGCCACGGCATCCTTCAGGACGTACCGGTCCGCAAGGAAGGACGGATCTCGGTGATCGCTTGGGGCTGGGTCGACGGCATGGAG
GAGACGGAGGCGGTGATCCCTACCGCGCCTGTGTTGGACCAAAAGACGAATGGAGCGAAGGGTGAGACGAAGAAGAGCGAGACTGGCGGTGCGGCTGAGC
GGAAGCCAAAGAAGAAGAAGGACAAGAACGCTCCGAAGCGCGCGATGTCCGCCTTCTTTATCTTCAGCAAGAGCGTGCGCGAGACAGTCAAGAGCGAGAA
GCCAGAGCTCGAGTTCCCGCAGGTGTCGGCTGAGATCAAGGACCGCTGGAATGCGCTGTCGGAAGAGGAGCGCAAGGTAGGTGGCGAGGATGGTCCATCT
TCGTTGACACCACCAGGTAGACTCACCTGAAGTGATTGTGCTGGTTGTTGTAGCCGTACGAGGAGAAGGCCGCGGCGGACAAGGTCCGATACTCGACGGA
AATGGAGAGCTACAAGGCGAGTGGGGCGACTGAGGTGAGGAGCTAGCTGTTCCACCAACTGCAGTGATGATGCGGACGCGATCTGACCTTGTATTTGCGC
CAGAAAGTCAAGCCCAACAGCGTGAAGAAGAAGGACCCGCTCGCCCCGAAGCGCGCGCACTCAGCCTACGTCTTCTTCTGCCTGGAAGTCCGCGAGTCGG
TGCAGGCCGAGAACCCGGAAGCCAAGTTCGCGGAGATCGGTGCGCTGCTGAACGCGAAATATCATGCGTTGTCGGACGATGATCGCGCCAAGTATCAGAA
GTTGCACGAGGACGACGTGGCTCGATACAAGAGCGAGATGGACGCGTACAGAAGCAGCAAGAAGTCGGTAGAGCAGGGCGAAGAGAAGGACAGCAGCGAG
AGCAAGCAGGAGGAGAAGGAGGAGGGTCGTCCGAGCGAGTAG