Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-0.36
Orientation:
(+)
Number of Exons:
3
Description :
3-hydroxy-3-methylglutaryl-coenzyme A reductase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Hydroxymethylglutaryl-CoA reductase, class I/II18.461PS50065
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-904
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
hydroxymethylglutaryl-CoA reductase (NADPH) activityGO:0004420IEA
KO ID
K00054
Cluster Id
4149
Sequence
        2887 bases(100 bases per row)
ATGACGAACCACCGCACGCTCGACGGGCTGGAAGCCGACCTGTCGGCGGCCATGCGTGTCGCGTTGCAAAGTCTGCAGGCTGCGCGCAAGCTCGCGACGT
CGCTAGATGGGGACTGCGACGCAATGGCGGCACAAGCTGAAGAGATTGCGGCTGCAGCTCGCGACCTGGTTGCATGCTGCAGCTCTGCGTCGCGGACGAA
GGGCAGCAGTCCCGAGAAGATCGCGGATGGTGAAGCTGACGACGAGGTGCCGCCGCCGCCAGCGTTCGCGCCGCTTGAGACGAGCGAGCATGCTGCGGAC
GAGTGGGCGGGGTCGCCAATTGCTCCCGCCAATCAGCAGCCGTCGGTCTGGTCGGGTTTCTACAACAAGACACTGCGCGAGCGCTTGGACGTGCTGGCGC
TCATGTACCCACGCGTCGCGCGGCCCAAGACGGCGCCGACTCAAGACGCCAGCGCAACTACCGCGACGGTCAACGACACGGGCGACGCGCTCGCGCGGCT
GGGCGAGTTGCCGCTGCGCACGGCCAACCACATGATCGAGAACTGCATCGGCACGATCGCGTTGCCGCTCGGTCTGGGACTCAACTTCGTCATCGACGGC
AGGAGCGTGTCGGTTCCGATGGCAGTCGAGGAGCCGTCAGTGGTCGCGGCCGCCTCGAGCGCCGCCAAGCTCGTTGNNNNNNNNNNGGCGCTGGCCAACA
CGTCGCTGTGCGCGAGCATGAAGAAGCGCGGCGGCGGTGCCGTCGACCTGTACTGCCGCGTTGTCAGCCAGCGCGCGCGAGCGCGGCAGGTCCAGGACCG
AGACGGCTCGTACTGGTACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGCAGACGAGCTCGACATCCAAGCGGCACGCGACG
ACGTCGAGTATCTGATTGTGCACGTGGACGTGGACGTGTGCGAGGCCATGGGTGCGAACGTGGTCAACACGGTGGCGGAGGGACTGGCGGACGAGGTGGC
GCGGCTCGCGCGCTGCCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCCTGACCAACCTGGCGATGCAGCGCCGCGCGCGCGCGACGT
TCGAGATCCCGGTGGCCAAGCTCGGGTGGAAGGGCGTGGCCGGCGAGGAAGTCGCCGCGCGGATTGTCGAGGCGTACAACTTTGCGGCCATCGACCCGTA
CCGCGCCGTGACGCATAACAAGGGCATCATGAACGGCGTCGACGCCGTAGCGCTCGCGACAGGTCAGGACTGGCGCGCGCTCGAGGCTTCGGCCCATTGC
TACGCGAGTCGCTCGGGCCAATACGCGTCGCTGTCCAAGTACGAGGTCGTGGACGTGAATGGCACCAGTGTGCTGCGCGGCTCGCTCGAGCTACCAGTGG
CCGTCGGGTCCAAGGGCGGCGCGCTGCTCACACACCCTGGGTACGCGTCCACGCACGCGGTGCTTCACCACCCGACGGCGCGCGAGCTCGGCGCCGTGCT
CGTGAGTGTCGGTCTCGCGCAGAACCTCGCGGCAGTGCGCGCCATCGCTGTCACGGGGATCCAGCGCGGCCACATGGCGCTACACGCGCGCAATTTGGCT
GTGGCGGCCGGCGCGCCAAGCGAACTCGTGGCGGAGGTGTGCAGCTACATGCTCGGACGCCAGTCCATCAATGTCGAGACGGCCAAGGAGTACCTGGCGG
CTCACGCCGTCTTTTCCGAGCTGCAGTCGTCTCCCCGCTCGCCTGTGGGCGGTTCGCAGACGCCGCCGCCATCGATGTTCTATGTGGAGCTGCCGATTCC
GCACCTGGAGGGCCACATCAGCCTCAACATTGCGTTCGAGGCCATCCACAAGCACCCGCAGTACATCGCGCTCGTGCCGTCGGGCTCGCCGTCACCGCTC
CAGCGCCAGTTGCTTGGAGACAAGGGCTACAACCAGCTCGAGAAGATGTTCCTGTTCCTCGAGTCGCTCCGCGCGATCGTACTGTCGGCGGTCAAGCGCG
ACCCGCCATCTCCGTCGCTTCGGGTCACACAGGCCAACCTGGCGCTGCAGAACAAGCTCCAGCTGCTCTCGATCCTGCTCAACATCGTCGCCTACCGACT
GCTCGAGGTGCGGCCGCAGTTCGTCCGAGCTTTCATGCTGAACATCCTCGGCGATGGCGAAGGTGCCGGTCTGGACGCCGCGCGGCACCGAACGCTGCTG
GCCGATGTTGCGGCTGACGACGACGTGCTGGCGATCGGCCTGCCGCTCTTCGTGGCGCTCTGGCAGGTTCTGCACTACCACATCGAGCAGGAAATCCCCG
TCGCGTTGCTGCGCGAGCGTCTCGTGCGCGAGCAGTGGCGACTGCTGGGGAACATCGTCAAGAGCTTCGAGCTCGGGCCGCTCACGGCTGTGGTTGCGAC
CGAGGCTCCGCGAGACAGCGACCCGGTCCAGCTGGACGCGCCGTTCCTCGAGTACGTCGCCGTGCAGACCAAGCGCTGGCAGGCGACGATGCTGCTGCTC
ATCGACTCGGCAGCGCTCGCGACCGACCTGGTGACCCCGGAGCGGCTCGACTTCCTCGCGCGCATCGGCGAGTACATGGAATGGGAGGGGACGATTGCGC
ATGACCTCGCTCGCTTCCACCGCGACCTGACTGAGCGTGTGCCCAACGCGTTCCTCTTCTGGCTCGCGCGCCGTGGTATCGCGTTTGCGGACGCCGACCA
GCACGTGGAGGAGTTCAGGAGGCTTGCGGACGCGCTTGGCGCCGACAAGTGGGCTCGCGTGTCTGCCGACAAGGCGTCGTGGCAGGCGTCGGCCTTCTCG
CTCCCCGCCGTCGAGCACGTCACGCGGCTCATCCACGAGATCTACGGCGAGCGTCGCGGCCGCAGGTCCCGCAAGGAGTCGTTCTGA