Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-snap-gene-0.44
Orientation:
(+)
Number of Exons:
4
Description :
Rho GTPase-activating protein gacA
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Rho GTPase-activating protein domain23.962PS50238
HmmSmart predictionP-Valprediction_id
Rho GTPase-activating protein domain2.2SM00324
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-256
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
signal transductionGO:0007165IEA
*** None ***
*** None ***
Sequence
        976 bases(100 bases per row)
ATGGAGGTTGTACAGGAACCGACTGTCGGTACTCCGATCGAAAACCGCATCAGCTGTCCCTACAAGACCCGCCAAGAGCTGCACGTCACGTACAACAACG
AGTGCGCACGCTACGAAGGACTCCCACCCGCATGGAGAGCCCTGAACGTCCAGTTCGGCCTGCCGTTGGAAGCCGTCCCAAAGCGGGATGTTGAGGGTTA
TGAGTCCAAGATCCCTGCAGTCCTGCAGATGATGAAGGAGTACTTGTTGTCACGAGGCGGGGTGTATTCCGAGGGTATATTCCGTTTGGCTCCCGATCGT
GACGAATGCGCCGCGGTCAAGCGTGCAATCAACGACGGCACTTTCACGGGCTGCACTGACATCAACGTGATTGCGAACCTAATCAAGGTACTGTTGGTCT
TGGTCGCTCATTTCTAAAGTGGCAAGTCTGATATCCAATTGGCTTGCTGTGATACTAGGTTTGGTTTCGAGAATTGCCCAAGAGTTTGTTCAGCGTGGTT
CCTGACAAGCACATCTACGCGGTGTGCGACCTCACGGTTGGTGCTTGCCGGCGTTGCAGATCGGCTGGCGATGTTTACTTACCCTTTGCGCGCTGAATAG
GACCCGGAACAGATTTTGAGGTCGATCGAGGCCTTTCCAGACCTGTACCGCAGTCTCGTTCTCTGGCTCCTCGATGTCATGGTTCTCGTCGTCCAGAACG
AGAGCACAAACAAAATGACGGCAAAGAACATGGGTACCCTTCTCTTTTGGCTATTAGCGTTGCCGCGCTCGATGGGAACTTGACGGATTGCTATTCTGTG
CAGCGATCGTCATGGCACCGAACCTGCTGAACATCTCAAGCGACAACCCCATGTTCGCGCTCACGATGTCCCAGAAAGTGGCCGACTTCACATTCGCGCT
GCTGCAAGCTCGACTCCAACAGGAGGAACACCGCGTCGTGTTTGGGAACATCGTCGACGGACGGCATAAGCACTAA