Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-1.8
Orientation:
(+)
Number of Exons:
4
Description :
FUN14 family protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain8.237PS50222
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
calcium ion bindingGO:0005509IEA
*** None ***
*** None ***
Sequence
        874 bases(100 bases per row)
ATGGTGCGGCCGCAGATGGTCAAGTTCGGCGCGCGCTCCATGTCCGCGGCCAAGAGCGCGCGCAGTCAGGCGATCGTCGCCCGGCTCCCGAGTACGTGGC
GTCGCGCTTGTCTTTGCAAGGCGACTCGCGAGGTGGAGGCTCTGACGTCAACGCGTTTGTGTGTGGTATAGCAGCGCAGTCGATCACGCGGGTGCCGCGC
CTGCTTGCGGTCGGCGCCGTGCTCAGTGCCGGTGCCGCCGCCGCCCTGTCGAGCGGTAAGCTTGGCTTGATTAGATGAAGCATGCGATGGTGGACTGGGA
CTCACCGCTGTGATGGCGCTTGGGACTGTAGACTCGGCACTGTGCGAGGACGTCATGCTGTTCTCGGCGGCGGTGCGTTCGGCTACATGTTTGACCTTGA
ACCGTCGCTGAAGAGGAGGAAGGGACACTCATTTCGGTGGTCCTGCTTGGGATGTGTGTGCAACTGTAGACTGGTCCTAGCGGCAGCGGCGATCCGTCCA
AGAAGAAGGCGCAGAACGACGCGGTCGAGCAGTGGATCGACAGTCTGCTGAGCCGCGCTGGCGAGGTGACGCTGGCGGGCGGTCTGGGCTTCTGCTCTGG
CTACGCGCTCAAGCAGGTGGGCAAGGCGGCGGCCGTGGCGGTGGGCATCGTCTTCCTGTTCGCGCAGGGAGCGGCGTCGCAGGGGTACATCAACATCAAC
TGGCACAAGGTACAGGCGGACGTGATCGCCAAGGTCGACACGACCGGCGACGGCAAGATCACGAACGAGGACCTGAAGCTCTGGTACGAGAAGCTGATGG
TTGTGCTGCGCAAGAACCTGCCGTCGTCGGCCGGGTTCTCTGGCGGCTTCGCGCTTGGCTTGGCGTGCTCGTAA