Transcript Name :
Pytve_DAOMBR484maker-pve_contig_1-fgenesh-gene-0.7
Orientation:
(+)
Number of Exons:
5
Description :
Surface protein Pls
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.5981.5070.003
*** None ***
TypeScore
nuclear348
GO
*** None ***
*** None ***
*** None ***
Sequence
        3782 bases(100 bases per row)
ATGGGCGGCGTCCACCACCGCACGCGGTACCACCACCACGCGGTGCCGACGGTGAAGGAGACGACGGCGAAGGAGGTGGACGAGGACCTCGAGGACGGCG
ACAGCGCTGACCTGGAGCTGTCGCCGAGCGAGGAGGCGGACCTGGACCTGGACCTGGACGACAGCGAGGAGGCCGACCTGGACGTGTCGCCGAGCGAGGA
CGTGGACCTGGAGATCCCGGAGGGCGAGGATGTGGACCTGGATGTTCCGGAGGGCGAGGACCTGGACCTGGACTTCTCGGCTGACACGGACGTGGACGTG
GACCTGGAGGGCGAGGACAGTGTGGACGTGGACGCCGGCAGCGACGACGACATCGACATCACGAGCGACGATACGCTGGACCTGGACAGCTCGATCTCGC
TCGATGGCAGCGACGAGCTGGACGGCGAGCTCGACTTTTACGAGGGCAGCGTGGACCTCGAGATCGACGACAGTGAGGACTACTCGCAGGAGCTGGACTA
TTCGGACGACGACGTGGTGGACGAGGTGATCGACCTGCCTGCCGGCGCCAAGTCGATCCATCTGCGCATCCACCGCGGCGACGTGGACGTGGAGATCATC
CGCGACGCGATCTCGTCGAAGAAGGATGCTCACACGGACTCTCACAAGAAGAAGGAGGCGAAGAAGGAGGAGAGCACGAAGAGCGAGGACGCTACCAAGA
CGGAGAGCGTGTCGTACGCTGCGGAGGCCGAGGACTGGATCAAGAACAACGCGAACAAGCCTGCGTTCCTTGCCGGTGTCATCGGCGCGGCCGTTGCCGT
TGTGGGCGTGGCCGGTGTGGCCATCGCGCGGAGCCGCAAGCGCGCTTCGGCTCGCTCGNNNNNNNNNNNNNNNNNNNNNNNGCGTCGGACGTGGCTGCCG
AGGAGGTGGAGGTCGTCGCGGAGGACGCGCCGGCCGAGTCGGACGACGACGAGTCGAGCAGCGACGAGGAGGAGCTCGCTGGTGCGGACGCGCTCACGAC
GGACGCGGCGGAGGACAAGGCCAGCGTCGTGGAGGGTTCTGTCTAAGTTGGGTGAGGGGAGATGAAGGCGCGAGCGATCGACTGACTGCCAGCAAGAGCG
GACGAGGGACGAGCGGTCGTTCAATAGGAAGGATGCGGCCCGACCGCAGGCGGTTGCTCGCGTCTGCAGTTTATGGGAGCCTGTTGTAAACAGCAACGTG
TATGAGGTATATTGTTCGGCGTTGGGTCCGCTCGAATGAAGAGCTTGCCATTCAGTCAGTCTCATACATGTGGCCGTTGCATGTGGTCGCTGTCTTCGCC
GCCACCGTCAGTCATTGCTCGCTCTGAATGGAAGGGGACGAGTTAAACCCGCCGAACCAGTGCAACGCTTACCGCATCGTTGCTACTGACTACTGACTGG
GTTCAAACATCATGGTGAAGTGGGACTGGCAGTCTGGTTTCTGAGCCATGGCTCACTGAAGACACAGATGCAGTCAACCACCGCCAAAAGTTGTTGGCTC
TCGGTCGCAGCAGTCGCCAGCGGGAAAGCCCGCGCCTGCATCCCACTGCGCCATTCCCGAGCACAGACTGTCCGTGGTCTTGGGACGAGCCGGCCAACTC
CGACTGGTTTGGCATGTGTCATGGGTCGTGATGGCTCATGAGTGCTCGCACCATCGGGTTTTGCCAATTGCACGAGCATCATTCACACGAGCCAAATTTA
GTCCGTTTCACGGATAGATAATAATCCTCGCGCCATGCGACTTGATCTTTGAGCCATGGCGGCGGCGCACAAGCAGCTCGTCCACGGACTCGTGGATGAC
AGCCACGACCGCGTGACACAGGCTCGCGCCGGCCAAACTCTGCATCGCATCTTGGCTCAACACGAGCGAGACGATAGTCACCACCGACTGCCTCAGGCGC
ATCGAGCCGGCCACGGAGCATCAAGTTCGAACATCGCGTCCGAGCTCGTGTTCAGTGCGCGGAGGAACGACCGAAAGGCGCTCGAGGGGGCTAGTGCGAC
GACGCAGGGCGATGGCGCGAAACATATTCGCAGGCGCGACGTGATCGCAGCGTCGGCTTCACTCGACAGCTTGACCGGAAACCCGGTTCAAAGCCTCCAC
ACTTCGTCAGAGCAGTTCACCGAGTACGTTCACCAGAAGAGCAACCGCGTGGGCATACCGCATCCGAATGACCGACGGAGAGGGGTGTTGCCCCAGGCCA
AGGACCTCCACAAGCTGGTGGCGGCGGTCGAGGCAACGACAGCAAAAGCGCATGAGAATGACCACCCCGCAGTCGAAGAGTCTTCCCAGTCCAAACTGAC
TCGCGCGCTGGCCAAGATCCGCGGCCAAGGCGCGTTCAACCAGCTCCAAGCGCATGCGCTACCTCCTGTCGGGCTACCAGCTTTCATCGGCGCGAAGAAC
CCGCACATGGCGTTCATGGAGTTTCGGCGCGAGATGGATGGCCAGCAGGGCAAGCGACGCATTCATCCGTAAGCTCTCGACTGGTGAGTACTGGCGCGAT
GCTTTGTTCGCGAACTGACCGACAGATTTGGCGTTTGTGCAGGAGTGTGGGTTTGCAGGACGGCAACACCACCACGAAGATCCCGATCAGGTTTGGAGAC
CAGGTCTGTTTGATCTCAACGGTGGCGCATGTTCCGCTGGCAGTTGGAGCGGACGGACGGAGCTCCACAGCTATCGACACTTCGGTCGGACCTCACATGT
CCTTCACGATAGTATGCAACTTGCAGTGCAGCATTCACCGAGGCAGACTGTCAACACTCATTGCCACTTGATGCTTGCAGGTGGACTTTTGTAATCCTAC
ACGACACGACGAGGTCACCATGCGTGACTCCTTTTGGCTGCGAGTGAACCCGGCAGCGCTCACTTCGGTGAACTCCGAGTCTGACGGAAACGACGAGGAA
GACGTCGCATCTCTTCTGGTCGACACGAACTACTTCTTGGGATGTCCGGGCTGGCTTGATGCTGGCTCCAGCAGCAAGACCGAATGCACGAAACAACCGA
AGAAGCGGAGAGGAGATGGACACGACAGCAGCAAGTTCTTTCGGCTCGTGGCGATGAAGGCGGACACGCCATCGCGCGACTACTACGGCGATGACGAGGC
GACCCGCGAGTATGCTCTGGAGACCAATGAGCATGTGTTTCGGCTCGCGCGATGGAAGATCTCGTTCCAACAGCAGCAGGCGGTGAAGCTTCCTCCTGCA
GTCGCGCTCGTACTAGAACAGAATGATGTGAACGACGCACTCTTGAACTGTTCAAACATCCAGCTGGCCCAGAACAGCGACTTTGTTCTGGCTTACGACC
CACACTTGCGCCGCGGAGTGTGCAGACCATTGTCCAAACGAACCCGGCAGCACATCAAGGGAAGCGACCGCGGGGATCGAGTTCGGCGGAGATGCGACGA
GGACACGCACACTAGCATTTGGCAGATCCGTCTTCTCCACCGTGAACAACGTGCGCAGGACAAAGCAGGGTCCAGCGGGGAGGATGGCTCCGATAGCGAC
GATCCGTCTGTCAAGTGGCTTCGAGACAAGCAGGCCATCATTGTGCGCAATGAAGCAAGACTCGAGGGCAGGCTCCAACTGGCTCAGCAAGCGCGGTCCG
AGTTTGAGAAGGTCGCGATCGAAAGCAACAGCAAGCTGGCTCAGATCGAAAAGCGCAAGTCTGAGCGAGCGCCAGTGTACTTCGAGCAGTTGGCTCACAC
GGTCGCCATATCTCCAATCGCAAGCAGTCCCAAGCGACTCGGCATCTCGGGTAGCGAGTCGAGGCTCCCAAGGTTACGATGA