Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1481-snap-gene-0.0
Orientation:
(+)
Number of Exons:
2
Description :
Gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-467
*** None ***
PositionContextScore
87QKSRSNR|HS0.554
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1419 bases(100 bases per row)
ATGTCGATCGGTACACTCAACCTGTCGTCACAAGCGACATCGTTCGTACCACGTCGCACCTTTGCAACGCCGGATCCTGCGAAGGATGTCCGCATGGAAG
CTGCTCAGgAaGATCGAGGCTCTAGTGGGATCGTGCCAAGGCACAACGGCAAGCCTCCGAGGCAGGATCCACCAGTCATGGAAGGTCGTCCGAaTGAGAC
TGGCGGTGGATCCTCAAGATCTCGAAGTAAGACGAAGCCGCAGAAGAGTCGATCTAACCGCCACTCAGACAGCGGTTCAGAGAGAGATATCGACAGTGTA
TACTCTGGGGCCGATTCTGATGAAGGTGATGGGACGCGAGAACACCCGATCCGAATCCGGACTGCATCGACGATCGAGCTCAAGAAGTTCTCTGGACGCG
ATGGCGACGAAGagCGAGCtCGGGAGTGGATCAATCGTCTCAGCcGtAaGGGCcGTCGTGACGCGTTTACGCCCGAAAAGATGCTGgATATCTTCTTtGA
CCACCTTACAGGGGGCGCAAAaCACTGgTACGACCAACTGCCTTCGGCAACATgCcGTCGATGGTCaTTTGTAGCTCAAGCGTTCGaGgAGAGGtACTGC
GGTCAAGGGATCCGTCATActGAaCGTTATtACACCATGACaCGTCGTTCcGAGGAGCCAGCTGTGGACTTCCTGTATCGTCTGAACGCGACCGCACGGA
AGGCCGGGATACagATCCGCGGGCGCCCGAGTGACCATCGAGCCCATATTCAGCGGTTCTACGCGTCCGTCAACGACGAGGATCTGGTCAAAACCCTGAT
TGGAAGTCAAGCCAGCACGGTCGATGAGCTCGAGGACACTTTGGTCGAGCTTGCGCGAAACCTCCGTCACTATGGGAGTCGAGAGTCGAAGACGACAGGA
GACACCAAATGGAAGACGAAGGACCAAGTGGACCCcAAAGGGAAGTCGAAGGATCTCCCAGCCCAACGCGATCGTTAGAATCCGCGAGTGAAGACCACGA
AGCCTGCGACGCAGAGAGCGGTGACGACGTCAGCGTCAGATTCCGATCCCAGTGACGGGGGgCAGGgACCCTCGGACAGCGAGAGATCTGGTGACGATAG
TGACCAGTACGAaGCCTATCCAgTCGTGGCGACGTTCcAGTCTCCACGCTACGCTGCTCATCGTGACAGATTTCCgTGCCCTATCTgTGGATCCCGTCGC
CATACGGAATCTGGGTGTTGGAAGAACATTCAGTGCGGTCGCTGCCAGCGAATGGGCCATCCTtCTGAACATTGTCGAGAGGTCTGCCAGGGATGTGGCG
AAGTCCATGACAAGGGCGACTGCAAGTTCGAGAAGTTCTTCAACGGGATTGCTGCGTGGTATAATCCAACCCGCCACGCACGTTTGCTCCCACCGGATCT
CGAGAAGGCTTTAAAATAG