Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1208-snap-gene-0.0
Orientation:
(-)
Number of Exons:
1
Description :
Reverse transcriptase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Chromo domain/shadow11.996PS50013
HmmSmart predictionP-Valprediction_id
Chromo domain/shadow5.1SM00298
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-142
NN-scoreoddsWeighted Score
0.9296.5760.013
PositionContextScore
91VDHRDRR|AA0.712
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        429 bases(100 bases per row)
CGCACCtGTGGCAcGGTcCgTTCCgcGTACTCGAGCGGCCCGACCATCACCTAGCCAAATTGAAGTTGGACGACACCGGTTATCGAtTTTTCCCACTGGT
ACACGTGAGTCGCCTGAAGTTGTGGCGTGAGTTCGAACCTCGTCCAGAAGTCGAGcCGGAGACAACCGAACGTTTTGACTTTGACGAAGCGTTGTTGCCC
GAGGACTCTTTCGAGCCAGACGCCGAAGCTGATGAGTACGAAGTCGAAGCGATTGTGGATCATCGAGACCGAAGGGCGGCACGCCAGGGGCGACCAGTGC
GCGAGTATTCGGTTCGTTGGGTTGGGTATGATACACTGGATTGGGTACATGAGGCCGACCTCAACGCTCCAAGTCTCCTGGAGGAATACAGTCAACGTCA
ACGAGCGCTTGGTCTTTTTGCGGCAAgGA