Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_827-snap-gene-0.3
Orientation:
(+)
Number of Exons:
2
Description :
MtN3
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-37
87-98
149-159
212-276
61-63
122-130
180-188
38-60
64-86
99-121
131-148
160-179
189-211
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        897 bases(100 bases per row)
ATGACCGTCGCCATCACCATCTTCCGTGTGCTTTCGTCATGCACCTCGATGTGCATGATGCTCAGCCCcATGCCGCTGATTGTGCACTCGTGCCGTACCA
AaTCCACGGGCTACGCATCGATTGTACCGCTTGTATCGATGCTCACGAACATCACCGTCTtGTAAGTCACGGACTcTTGGAAttAAGTTGATTTCACGTa
CGAAATCTCACGCTGTGACTGATGCAGAaTCATCTACGGCTACCTCACGGAGCAATACTTCCCCGTCTTCGCGACGTTCCTCGTCGGCTGGTTCCTCGCG
CTCTCGTACGTCTCGTTGTTCTACCGATACTCGCATGAAAAGTCCAAGGCCCACAAGGTCTTTCTCGGCTATGGCATTCCGCTCTTTTGTGTCGTGACCT
ACGCTGTGCTTGGTTCCGCTGGTGTGACACATCAGACCCGCCACCAAGTTGGCGATGTCGTTGGATATGTTACCATCCTCACGGGTATCATTGTCTTCTC
GTCACCCTTGGaGAAAGTTGGTCCGGTGCTGAAGCATCGATCGGCCGTGTTTCTTCCTATCCACATGGTGTGCGCCGGCACGATCAACAACCTCATGTGG
ACATGCTATGGTGCTCTTACATGGCGATGGATTCTCCTCGTTCCCAACGCGATTTCCCTCGTCTCCGGGTGTTTTCAGCTCGTGCTTTATGCCATTTTTt
ACCCCGCGACACACCCAATCACCAGCCCAGACGCATTAACAGcgTCCGACTCGGATGACAAGTTCGACCTCGAGGCCGGACGACACGACACATCAAGCAC
GGCTATCGACGACACCGATAAAGACGACTTTGTGgAGCTGGAaTCGCCTCGGTCCCCTACGTCAAAGACAGTTGAACTCAAAATGTCTGTTgtttGA