Transcript Name :
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_536-abinit-gene-0.27
Orientation:
(-)
Number of Exons:
5
Description :
GTP-dependent nucleic acid-binding protein engD
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
GTP binding domain2.6PR00326
GTP binding domain2.6PR00326
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-437
NN-scoreoddsWeighted Score
0.5162.9820.006
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
*** None ***
*** None ***
Sequence
        2370 bases(100 bases per row)
TCGTCCGCGTGAAGGAGTGGCtcGagGCTGGCAAGGACGTCTCGTTCGGCCAATGGAGCACGCTGGAAGTGGACGTGCTTAACCAGCTGCAGCTGCTGAC
CGCTAAGCCGGTGGTGTTCCTTGTGAACGTGAGCAAGAAGGACTACCTCCGCAAGGGCAACAAGTACCTTCCAAAGATCGCCGAGTTCATCAAGGAGCGT
GGTGGTGATGAGCCATTGATCCCGTTGAGCTGCGAGTTCGAGCTTGAGCTGCTGGATCTCGAGGCCTCTGGTCAGCTGGAGACGTACCTGAAGGAGAACC
CAACGCACAAGTCAACTCTGAACCGTGTCCTTAAGATGGGATACCATGCGCTTGGCTTGATCCACTTCTTTACCtTTGGTAAGGTGGAAGTGCGTGGCTG
GACCATCCGTAAGGGTCGTCTGGCACCACAGGCTGCCGGTGTGATCCACTCagACTTTGAGCGTGGTTTCATCATGGCTGAAGTCCAGGCCTTCGCCGAC
CTGAAAGAGCGTAAGTGCACGAGGTTTGATGATTCTGTGCTGGAGTAGTCATTAATGTTGTTGATATTTGTACGTAGTTGGATCAGAGGAAGCAGTCAAG
AAGGCCGGCAAGTTGAAgCAACAGGGCAAGAAATACGAAGTGCAGGACGGTGACTGTATTTTTTCAAGTTTAACACGTAAGCGGGATCTTGCCGTTTCAT
AATGGAATAGGTTAATTTAGCGGACTACTGAATCAAGAGCGATTCAGTTAAGTTAACACCAGCTGTCAACCGGTATCTAGACCGGTTTCTGCTCCCAAAT
CTCCAAGCAGGACCAGTCATAGCAATCCTCATTGGGATAATCAGTCGCCACCAGCAATATGCCGCCAAAGAAGAAGGAAGTACGTCCACCTCCTTCGGGC
TGCTCCCCCAATTGATGGGCTTCTTCTACAGCGAACCATCAAACTAACGAATGCGCCCAATCTGCGTACTCTTTACGCTTCTCTAATCGACAGGAAGCGC
CACCAAAGGTGTACCTTGGTCGTCCAGGTAACAATGTCAAGATCGGTATCGTCGGTCTGCCGAAtGTTGGCAAGAGTACGtTctTCAACTGTCTGTCGAA
GATGAACATCCCTGCGGAGAACTTCCCGTTCTGTACgaTTGAGCCCAACGAGGCTGTCGTGCCGGTGCCGGACCAGCGTTTCAACTGGCTGGTCGagAAg
GTCAAGCCaCAAAACACGTGCGTATTGGCAACTTGGCTGCAAAGGAGGCGAGTTGACACTGACACAAATCTATGTGTAGTGtgCCTCCAGTGATGACCAT
CACGGATATTGCTGGTCTCGTCAAGGGTGCTGCTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTCCGTGTAC
AGCAGTGGCTTGAGGCTGGCAAGGATGTGtCCTTTGGTCAGTGGAATGCCCTTGAGGTGGACGTGCTTAACCAGCTGCAGCTGCTGACCGCTAAGCCGGT
GGTGTTCCTTGTGAACGTGAGCAAGAAGGACTACCTCCGCAAGGGCAACAAGTACCTTCCAAAGATCGCCGAGTTCATCAAGGAGCGTGGTGGTGATGAG
CCATTGATCCCATTGAGCTGCGAGTTCGAGCTTGAGCTGCTGGATCTCGAGGCCTCTGGCCAGCTGGAGACGTACCTGAAGGAGAACCCAACGCACAAGT
CGACTCTGAACCGTGTTCTTAAGATGGGATACCACGCCCTCAACCTCATTCACTTCTTCACCGCTGGTAAGGACGAGGTTCGTGGCTGGACCATCCGTAA
GGGTCGTCTGGCACCACAGGCTgCCGGTGTGATCCACTCAGACTTTGAGCGTGGTTTCATCATGGCTGAAGTCCAGGCCTTCGCCGACCTGAAAGAGCGT
AAGTTATGCTGCTGTCGTACGAGcACCAATCCTCGTCAAGAGCTGACACTCTTGTTTATAtcATGCAGTGGGATCGGAGGAAGCAGTCAAGAAGGCCGGC
AAGTTGAAGCAGCAGGGCAAGAAGTACGAAATGCAGGACGGCGACGTTGTGtTTTTCAAGTTCAACACCT