Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_352-fgenesh-gene-0.9
Orientation:
(-)
Number of Exons:
2
Description :
Pterin-4-alpha-carbinolamine dehydratase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-125
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        439 bases(100 bases per row)
ATGCTCGGAgCTCTTCGCCTACGATCGACGGCTGCGCTGCGCCTGCAGACGCACAACCAACGCTGGATGAGCGCCGTGCCTACGAAGCTCAGTGGAGAGG
AGCGCACCAAGGCGCTGCAGCAGATCAGCAGCGCATGGCAACTGGTCGAGAACCGCGACGCCaTCACACGCACGTTCCAGTTCAACGACTTTAATGAAGC
CTGGAGCTTCATGAGCCGCACGGCACTACTGGCCGAGCAGATGCGCCATCACCCAGAGTGGTTTAACGTGTACAACCGTGTGGAAGTGACGCTCAGCACG
CACGACTGTAATGGACTGTCGAAGAACGTACGTAGTAGTTGAGACGGATGAGCGTTCAGGAAATGTGCTTAACTTGTGTGGTTTGTAGGACATTGAGATG
GCGCTCACCATGAACAAGTACGCTGAGGcCCTCAAGTAG