Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_267-snap-gene-0.17
Orientation:
(-)
Number of Exons:
5
Description :
CCR4-NOT transcription complex subunit
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Tetratricopeptide repeat-containing domain8.216PS50293
Tetratricopeptide repeat-containing domain8.789PS50293
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat490SM00028
Tetratricopeptide repeat370SM00028
Tetratricopeptide repeat0.49SM00028
Tetratricopeptide repeat120SM00028
Tetratricopeptide repeat26SM00028
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-702
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
KO ID
K12607
*** None ***
Sequence
        2364 bases(100 bases per row)
ATGTCGGGGGAAGCGAGAGGGAAAGACAACAAGTCGTCGCTCGCGCATCGCGCGCAGCAAAAGTACAAGTGAGTGCGGCCAGACCGGTGGCTGGATCGCG
ATGGGCTGACGTGACGCTCCTTGTGCCTCCCCCCCACAGCGCTGGCAAGTACGTGGAAGCGATTGACGCACTGCAGAAGCTGTCTGAAGAGATCGCGCCT
GATCGGGATGTCAAGGTGCAGCACAACCTCGTGCTGGCGGGTTTCGTGTCGGGTAAATACGCCGCGAAGGACTTCGAGAACAGCCTGCGCAACCTGCTGA
GCTCGCTTGCCGATGATGTGGATAAGAAGCGTGGAGGTGCCGACGTTGATGCGGGCGTGTCGCTCGAGCGCGAGGCATCGTTTATTCGCTACAACCTTGC
GGCAGCACTGTTCCAGCAGAAGCAATATGCTGCCGCGAGTGCTGTGTTGGACGTGCTGATGCGCAACATCGAGCCAATTGATGaAAAAGTGGCCATGCAC
GTGTGCtTTCTGTACCTAGACATCATTCTGCACAGCAGTCGCGGTTGTGTGTCGACGGAGCGAGAGCGTTTTGCCACACTGAAGAAGGCGCAGTCCATTT
TGGCGTATTTGGAGaAACCCCaCGGTTTCAATGGCCAACTTTTAAGCCATACGGATGACAGTAGCAACGCGGCGAGCGCCGATGCTTCAGCTGGGGAGCA
AACCAAGAAGGAtACTTTGGATGTCGTCGAGTTCCGATTCCGTCTGCACCTGTACAAGGCCAAGATTATGCTCCTACAGAGTAACCTGAAGACCGCAAAG
AAAGAAGTCAAGTCCGCTCTGGAGATTTTCCAGAAAGAGATCAAGACCCGTGATCGTCAGGACGACGCGGCAACTACGGTTGGCGGAACTTCTAGTCTCG
ACAAAACGTCTACAGCAATTGGACACCCGTCGTTGGCAGTGCAGAAGTCAACGGGGTTGTTTCTCAAGGCAAATCTAGAGTACTTACGTACCAACTACAA
AAAGTGCATCAAGTTGTTGGCATCATGTGTGCAACAAGCCGTGGATGAGAGCATTTTCCTTAACAACATGGGCTGCATTCACTTCCAGATGGGCCAACGA
AAGGCAGCTCAGTCGTATTTTGCACGAGCACTTGACGCATCTTCGAAGTCACGCAAGACAACACAAGAGGCTGAAGTCATCACGGTATGTTAGGTAAAGA
TGAACTACTAGCCTTGGTGGTGATTGCTAATCATGCTTTGCGACAGACCTCATCCCAGTATGAAATCTTGTACAACAATGGCTTGCATCTTCTGCTTCAG
GGCGATTATGCGTTAGCATTTCGATGCTTTCATGCATCATCGCGAATGTTCTTCAACCGTCCCAAGTTGTGGCTCCGAATGGGCGAGTGCTGCACTGCTG
CATTTGCACAACAAGCGAAGCTCGCTGCCACAGCCGGAAATAAGagTGGTCTGATTCAGGGTATTGTTGGGTCTGGGTCtCAtCGCCGTGTTCTCCTctC
GACATCTCAACCGTCAACTGGAGCTGGAGACATCGAGTTACCTGACAAGaACGCAAAAGGaAACAATGCGAACGGCATGGTGACTTCTGGGCCAGATGGA
GCACCGAAGATGAACCTTCCATTTGCTGCGAAGTGTTTCAAGAATGTCGTACTGCTCTGTAACCAATTGCTCGAAACAACTGCCAAGACGAACGGTGCAT
CGGTCTTCGGTGGTGCTTTGGCAGGTGACGCTGACGGCGCTGAGAGTGCACAGTCAAGCCGCGAAGCACTCGATTTAtTGCGACAGAAAGCTctTGTCAA
CTTGTCGTACGTGTATCTGTCGATGTATGAGCCTCAACTTGCTATCACGAGTGCCAAAGAACTTCTGTCTCTTCCATCCTGCACGAAGCCCAACAGGTAT
GTGATGGCGCTTTAAGATAACCGTATCCTGAGGCTGATCGTTTGtTGCCGCAGATTCCtTGCTCGCTCATATGCAGCAGAAGCACTGTGTATGCTGTCGC
GCGCACAAGaAGCAACACAGGTGCTACAGGCCGAGCGTGATCTCATGCACAATGCGGAGCAGTATGCAAGTGAAGCTAAGATTCAGGTGCGTTTGTGTCC
TCCAGACAAGAGTTACTTTGGGACTAATAATTACACCATGTTGTTGAATAGGTCAACACTGcCCGTGCTGCGGTCCACGTGAACAATGCGACAGCGCTGA
TCCTTCAGGGTCGCGTGGCAGAAGCCGAGGAGAGTGTGTCTCGAGCTGTGAGCGAGAACGCATCCTGTCGAGAGTCGCTTGAGCTCTTGGTGTATTTCTA
TCTGAAGAAGGGTGACACGAAGAAGGCGCTGCGCGTCCTGAAAGAAGCGCAAGTTGCTGCGTAG