Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_182-fgenesh-gene-0.2
Orientation:
(+)
Number of Exons:
6
Description :
COMPASS component SWD2
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40 repeat14.853PS50082
WD40-repeat-containing domain14.503PS50294
HmmSmart predictionP-Valprediction_id
WD40 repeat7.6SM00320
WD40 repeat4.9SM00320
WD40 repeat0.37SM00320
WD40 repeat1.5SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-350
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
KO ID
K14962
*** None ***
Sequence
        1373 bases(100 bases per row)
ATGGCGGCGGCGGGGGgCGTCGCGCTCAATGACGAGCTCGTACGGCGGTATGGACCCGTGCGGAACTTCAAGACACAGGTGCGAGTGATATGTGCGGGTT
TGCGCGTGAGTTTGAGGCGCTGAAATGATCtcGTTGCCGCAGGAGGAAGAGGAACAGGACgCGCTCGTGACGTCCATTAGCTTCCATCAGCAAGGCGAGC
GCTGTGTCACTAGCCGCAACGACGGCGTCGTGTCCGTCATCAACTGCCTTAGTGGAACGTAAGTGCGCTAATTATGCAGAGCCATACGACGAGTACAGAG
TGATAACAGTGTGATGACGACGTGAGCAGCATCACGAAGACGATCTTCTCGAAGCGCTACGGTGTTGACCTCATCCGCTTCACGCACCACCCGGACTGTG
TGCTCTTCTCGTCTCTGAACGACGCCAATGATTGTAcGTCCCAATtGGCTCACTATGCAATGCGAGTAGTGGACACTAACGTATGCATGTGACTACAGAT
CGCATCCGCTACCACTCACTGTTCGATAACAAGTTCCTCCGCTACTACTCCGGCCATGTCAACAAGTATGCGCCACTCTCTCaGCtgtATACTGTCTCCA
TATTGATGTATGCGTTGCCGCTATCGTAGAGTGACGACGCTGATGATGCACCCTACAAGCGATGAATTCATGTCAGCATCACTTGACGGCACTATTCGCC
TATGGGATGTCCGTTGTGCTGACACGGCGGTAGGCACTCCGAGTTTTGATTCAAGGAAACTATGTCGCGCTGACTAACAACTGTGTAGGCCATGATTCGC
ACCGACCACATGCCTGTGACGCACGTGTCAGCGGCGTACGACACGGAGGGCGTCGTGTTcGGTGTGTACACAGATGATCATCTCATCCGCATGTACGATG
CGCGCAACTATCAGGAGGGTCCGTTCGCCAAGTTCTCGCTCTACGACAGTTCCATCCTGCGTGTTCTCGACCCGCATTTCGCCCAGATGCAGGCGCCAAA
CTTGAACGTCGCCAAGCTACATGCGGTCGACCTCAAGTTTAGCCCGGATGGCAATCAGCTGCtcGTGACGACAAAtcGcGGTGTGTTCCTGCATCTTGAT
GCCTTTGAAGGTCACTTGCTGCACTTGTTCAACAAGCATGCAGCAAACCCAGTGAATGGCCCACAGCTAGGtgCGTGCTACTCGCCGGATGGTGCGTACG
TCACAACAGGCTCGGAAGATGGGCGGgTGTTTGtGTACCGCTCCTCGAACGGCGAACTTGTGCACACATTGGCTCGAGGTCATCAGGGAGCGATTCTAGA
CATGgCATGGAACCCACAGCGACACCTTCTGGGCACTGcGGGCTCTAATTCATGTGTCCTGTGGAGTCCAGGG