Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_174-fgenesh-gene-0.0
Orientation:
(+)
Number of Exons:
5
Description :
ATP-binding Cassette (ABC) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain10.654PS50294
WD40 repeat11.11PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat7.2SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1183
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        4537 bases(100 bases per row)
GAACCGAAGACTCTAAAGCAGCTTCACCAAGAAGCAGTGAAGGAGGaCAAaGGGCTGGTGATCTATGCTGGAGGCGATTTGGACTCTCAGCAGGATGGTT
TGCGTTCTGCATGGAAGGCTGCCTACCCCGACaTCAACCTGACGATCGTCGTGGACTACTCCAAGTTCCATGACGTTCGCATCAACAACCAGCTCGCGCG
CAACCGCCTTcAGCCGGACATTGCGATGCTTCAGACGCTGCAGAACTTCCCACGTTGGGCCAAGAATGGTGATCTGCTGCAGTATAAGCCAaCCGGATTC
TCCCAAATCTACGACGGATTCAAGGACCAAGAGGGCTTCTGGATGGCTCATTCGATGATCTCGTTCGGCACATTTTACGACGCCACGCAGCTTGGAGATC
TTCCGACGCCGAAGTCGCCTCTCGACTTTGCCAACCCCAAGTGGGCTGGAAAGCTCGCGTCGGCTTACCCAAATGACGATGACGCGACCCTCTtgTGTAC
TCGCAGTACGTTAAGAAGTATGGCTGGGACTGGCTTGACAAGCTGTCGAAGCAGGAGATCGAGTTCAACCGTGGCgCGCACACGCCGTTTGATGCTGTTC
tGACAAGCCGTCGCCGTGTTGCGGGCCTGGGCATCGGTATCAACATCGGTGCCAACTCGACTTCTCGCGTGGCTCCACTAGCTGGAAACGGCGTCCCATT
TGTTTgcTGGGGCCAGCGACTCGCGATCTTTAAGAAGGCGAAGCACCCTGCCGCaGCCAAGCTCTTCATGAACTGGGTCGTCTCGAAGAACGTACAGAGC
ACCGCCATGGCTGGTTTCTCGGTTCGTACGGACGTCACGCCTCcGCTTGGCGGCGACAACTACACTTGGAACATCAAGGAGGCCAACGTGGATGAaTTCC
CTGCTTTCATGGCTGATCGTGCCGAGGTGGAGCGCTGGCGCCAGACGTTTTCGCTGTACTTTGGTGAGGTCCAGGGAAAGCCAAGCCcAGGCTGGTTCGg
CCCTCTTCCAGGTCAGTAAGAAGCCcTcGATGCTCGGCTGTAAGCTCGACACTTGCGTAATATAAtGACGTGGGTCCTAAATCGACGTGTCTGACGTTGC
TTTCaTtGTCTATGAACCTTGCGTTTTgtAAATACCGTATATCActGATAACACCACACGAAGACGTGGATGACAGCACGCTGCTCGAAGCATTCATTCA
CTCATACTCACAGTCACACACGAGCTTGGTCCTCATGATGCATCGgTAATCGGtAaTcGgtaTTTTCCATTTTCCATTTtGGCATTtcAAATTAGTCTAG
GCTAGGCAAGCCTACGAGTGTAACCTGAAGGGTAACCCCTCTTGGCATCCAAGGAAACACTTGGGCGCCATGAtGGAGCCAaCCGCCACACCCGATGAAG
CTGAAGTCGTGCGTTTAGATGTCGATATCTCGGCAACCACGACGACGATGAACCAAGcAAATGGCTCATCCGATGCGtcTTCATCCGTtGTATCTGCGTC
GGCGGTGGCGTCGCTGGTGGAGTCTCACTCGCGTGAGCGCATCGCCGGCAGTCCGCTCGTCCCTAACGGTGTGCGCTGGTCAGAAGATGGACGCGTCGCG
GTTGTTTCGGAGGCGAGCATCATGATCTCGACGTTTATGAGCCGAGAGCTCGAGATGTACATCCAGCACAGCCCAGCGATCTCCAAGAGCTTCATCTTCG
TGCCTGAGGCGGCGCAGGTCGCGACGGAACACGTGCCGCTCAAGATCCCTGTCTTCAATGAACCAACCGGCGTGGCCTTGCCGGGCGGCAGCCTCACGTA
CTTCTtACTACATGAGAAAGACCGGCATCAATACAACCCGAAGGAGCTGTCGCTGTCCAAGAACGACGGCACGGCGTTTCTCTCGGCCACATGGGGGCCG
CGTGGTTCTGGCCCTAATGCGTCATGTGCCATGCTCGCCCTCACGGCGTCCTCGCGCATTAGCCTGCACTTCTCCTCGAGCTTCCATCTGAGCTGGAAAG
AAGTCGCGGTGTTCTCTGAGTGCCTCTTCCAATTCATGGAGTCGCGGCAATGGGCACTCAAGAGTAGCGGGTCcTCCGCCGCGGCAGCCCCGCCCAAGAC
CGCCGTGACAGTCAAGAGCGAGGCCGTGCAGGCAGCTGCACCGACGAAGAAAGGAGGCCGAGGCGGTGGTGCTCTCGGTGGTGTGGCGTCGAAGAAGCGC
AAGCGCGCGgTGCCGCAGGGAGATGGCTCCAACACCCTCAGCATGGACGAATACACGCGACGCAGCGCCCTTGtGAGCACACTTTCGATGGCGTGGTCCC
CGTTCGTGACCAACACAGAGCAGCACACAACATCGCTCATTGCATTGTGCGGACGCGCCATTACAACGATCTGGGGgTACGACTACCCGTCATTTGAAGC
GTTTGCGTCGGTGGACGGCGATGCCCGGTCCAGCACGAGCCGAGCCACGAGCTTTCTTTCTTCAACGCCGTTTGTGTGGATCGATACCGAGCAATACGGA
TGGGTCTCGACATGCACATGGCAGCAGATGCATCGATCTCAAGGCCAAGTGCATGCCGACCTTCGCTTGGCTATGGGTACgTCGGAAGGAAaGGTGTTGT
TGgCcAaCATtCCcGTCATGCCACGCGACGTCAACGTGTCGGAGATCGCCGTCGATCGAGTGATCCTTGCCCcGCACTCACAGCCAGTGTTtGGgCTGCG
ATTGGGCTCCCGCCACACGTTCACCGACAGCCCACGTAACGATCTCGTTGTGGCCTCGGGTTCGAGAATCTCCGTGTGGAACATTAACAAGCGCCGAGGT
CCGTCCATGTCGTGGAAAGCTCACACAGGCAAtATCACAGGGcTCGACCTCGACTACTTCGGGGACCTGATCTTTTCCTGTGGTGTGGATGGGCAAATCA
AGCTGTGGGaGAAAGAGTCAGGAAAGGAGTTGTCATTCGTCTCGACAGCCaCCACTGGCCGCACGGTAGACAACGATGGCTCTTCGACCACTGCACGCTA
TCCGATGTATGGGCTCTCTGTGTCTCCGAACTCGGCGCAGATCGCGTGTATGTACGTCATTCCTCCAGCGGCAAGGCCAAACCGGAAGTCCCAAGCCGAC
GTGTCGTACAGCCGCGTGTCAATCTCGCTTGAGTATCTCCCGACGCCCTACGCCTCATTGTCGTCGTCATTCGTGCAGACCATGTGCACGATCCTCGAgc
AAGGTCGTGACATGAGTACCATGACTGACGTGCTGTGGTTTTGCCACGAAGACAATGCCTCGATCACGTCACTCCAGGGTTCAGCAGACCTCACACTGCC
TCACTTGCTGAACAAACTCAAAGGCGTAAGTGGCGGTGGTCGGAACGGCGAAGAAGCTCGGCAGCCGCTGTACTTGAGTCTTTGTGAAGAGCTGGAGAAG
CGGTACTTCGAGAATTCCTCAAGGGATGACCCTGCTCCGGGTGAGTCCTCACTGCCCCTCTTCCTCCAGGGCTCGTACTTGCTGCGTAGCTGCATCACGC
CTGCCGAGCATCACgtAGCAGTTCGTGATGAGGCGCTGGTCAAAATCAAGCGAACACTGTACGTGTACTGGGCAGAGCGATGCCTGAAGGAGCTGATGGC
TTCGCATAGCCAAGTACAGAACTTTGCTGACATCTCGAAGACGGAACGTATCAGTGCGTTGCTCATGGCTGATTTCCTCAGTGTCCAGCAGCCTATGAGT
GCCAGCTGTGAGCGACTCGTGACCACGATCTACAACCGCCTTGGCTCCGATGACAACATCACACGCTGGTCAGCGTATCTGAAAGAGCGAGTGGACTACT
CGAACAAGAAGAAGACGAAACCAGCACcAAGCACAGAGACAATGGAAGAGGACCACGAGcccGTGGcccctGTGCCTCCACCTCGTCAGACGTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNgggccacgtacagga
ccggtgctttctctcttttcaagttctcgcatccatggACACGTGGAAGTGCATGGGCTGCGGTGCTTCCGCGTGCGAGATCGACTTTTCCTTCGGGCGT
TCCCCCTTCTACCTTCTCGAGAGCCACAGTGAGGCTaCTGCCAAGTCCTCAACAGGCGCCACGATGCAGATCGAATGCCGCCTCTGCGGTAACTACTGTA
GTTtCTTGCGATACTGAaCCAAAATGCAGTCAATTGA