Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_146-fgenesh-gene-0.16
Orientation:
(-)
Number of Exons:
7
Description :
Calcium-dependent protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain5.754PS50222
EF-hand domain10.496PS50222
EF-hand domain9.632PS50222
EF-hand domain14.374PS50222
HmmSmart predictionP-Valprediction_id
EF-hand domain1.2SM00054
EF-hand domain3.2SM00054
EF-hand domain3.9SM00054
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-690
*** None ***
PositionContextScore
260CMQRGGR|SA0.511
*** None ***
GO
Biological ProcessGO IDPrediction Method
calcium ion bindingGO:0005509IEA
*** None ***
*** None ***
Sequence
        4027 bases(100 bases per row)
ATGAGCGATTCCAAGGCGACGCCGGCCGCCGTGCCCAGCGACGCGCCGTCTGCAGGGCCAGCATCGGCACCGCCCGTTGATGCACTCGCTGTACCAGCTG
CAGCCGGAGAGGCGACCACTCAGAGTGGCGCGGCGACGCCCAATGGCACTACCAGTGCCGCTAgTGGCAGTGCAGCGACGACGGCGGCAGCGGCGGCTTC
CCGCAAGCGCGTCTTCACGTTCCAGAAGCGCTGGCTGCACACTCTACCCATCATGGAGAAGACGTTACCTGACAGCGCACTGGATGCCGCGAGCTTTGCT
GCGCTCAAGTCTGCGAACCTTGTGGGAGATGATGGGAAGCCTGTCGACGATGCCAATGCGCaTGACGTGATTGTGTGCATGCTGTGCGATGACCCGCATT
CCAATCGAGATGTGATGAAGATCTGGAGTCGACTTAATTGCCGACGCGGACGCATTGAGAAtcACTTGATGAGCAAGCACCCAGAGTTCATGTTGCTGTT
GAAGCAAAAGCGGGAGGCTGAAGGAGATCTGGCCGTGCAGATTTTTCTTCAAAACATGCGCGAAGGGAGATGCAACGTACGGAGCGAGATCAGCTCTGGG
CTGTACAGTAACATGCAGGCAACCTTGGCACCTGGTACTGCCCAcGCACACAGTGAGCTGCAGCTACAAGCCCAGAAGCGGACTTTTGGTCACGACGATT
TCATGATGCCTGCTCAAGCAACTGTCAATGTCACTGCAGGCCTTcCATACAGAAATATGAGAGACGCATCTGACGTCTCAGATGTGGAGAACCGACGGAA
GCGAGCCAAGTCCAATGGAAATGGTCGTGACGGTGTTGTCGCAACGCCAATGATGTTGGCAAATGCACCAGTTCCTCCAAGTCCTGTGGAACCAGTCCAG
CGAGGGCCCTTAGCCGCGTTCGGCGAACTGCTTCACGCAGCTCTTATGTCCTACaTTGGCCCAGTGGGATTTGCTCAATGGCGCGGTGCGCTCGCAGACa
aAATGGtTCGTAGACGAGCGAGGAGCGGTAGTAATGAGTGCTGACATCGTCGATCTTTCAGGTGGTCATAACTGGCGGTGAGCGCCCATCCATTGCCCGT
GCTGCGTCAAATTTGTGGCTGATGGGTGCAAATGtTCTGGTCAcCTTCGCGTAAGtATACTTTCATGCTCTTTGTTTgGGCGTCTGCATCGATGCTAACT
GGATACGATTTAGTGACCAGGAATCGACAGAGGCCTTCGCAGCTAGCTACCTAGCCCAGCTCCACAATACTGAGGGTGTTGAACCACCACGCGGCGTGAT
GCTGCCtTTGTTCTGTTCATTGCATAcCCGTcCCCAGATTGACGAATGGACTCGGTCAATCGCTTCCAAGTTCGAgAGGGTCGACTTCCTTATCAACTTT
GTTGGCGAGGAAAGTGACTCGAAAAAGaACGATGCAGCGTCtTTGAGCGATGCTGCAGGTGCAAACAGAGAAAGGAGCAAGAGCAATGTCGATGAATCGA
TATCTTCGAGCGCGTAAGTGTGTGTCTGATCGTCGTCACGACATGATGTATCTGACAGTGTCGTCACGCATAAGCAGGAATCGCATACTGGAGATTTGTC
AGGCATTCAGTTCTACCTGCATGCAGCGAGGCGGACGAAGTGCTATTGTGAACATCACGACGCAGTCGGACAACGTGTGAGttTTTTTTTCAGTGTAGCT
GTCTCCGTGTTGAGAATGGCTGACTCCTTATATTCGTCTGGCAGTCGGACAAGTATGAATTGTGCTGCAATTGAAGTGATGACCAAATCGCTATCGAACG
ATCTGCGGGCGTCTCAGGTGCAAGTGAACTGCATTGTGGTGGAGCAAAGCGGCAATGACACAAGCGAAGCCAGTGCCGAGCAGGAGCTGGAGCTGCTGCA
CACGAtTcTGTTCCTCCTCTCTcCTGCCAGcAcCCGCATTAGCGGTAGTGTGATcCACCAGAGAAGACaAGAAGccaCGACGCGATCTGCTGCTGGTGCA
GAGCCCAtTACCACgCAGTCGACGACCGCCGAGGCGATCGACGTTGTGCAAAACCAAGTCATTTAGTCTCATGTAGCCATGACGTGCGTTTAGTAAAACT
GTGACGTGTTAGAATCGGTGACTGCTTTAGTCTCCCCTGGGGTCCTATTGTCGGTTGACGTGCGCCAAAGCGTTCGTCTGGCGTTTCAGCATCGTGTGTC
ATCTGGTTCATGCGTCGGGCCGTCGCCAGCACTCCGCTCTGTGACTGCGACGCCTCTCGTGACTcCCCCCATGCACAGCGTCCTATGGAACCAATGCAGG
CGcCtGCGCCCTCGCCAGGCGCGCGCACTGCTCACGGATGTGGCACGCCGCCCGACAGACACGCGTGAAGCGACGTCGTCGTCGTTCAGCCGCGTGCCGA
ATGCGcCCTCAGTgGCGGCTGCAGAGGCCGCTCAGTTTGGCAGCGTGCGGCGCGCGTGGCGTCCTCTGCTGGAGAAGCTGCATGCAGTGCCGGTGCTGCA
ACGGCTGGCGCTCGAGACGGCGTCTTACTTCACAACCCCCAGTGAGATCGAcTTCCACTTGCCACGAGAcTTCCAGACCAAGTACCAGGTCGCGGAGCTG
CTGGGTGAAGGCGCGTTTGGTCGAGTGCACCGCGCGGTTGCTATGGACGAGCACTCGGATCTCGACCTTGCAGTCAAGATCATTCCCAAGACACGTGTCG
TGAATCTCGCCGACTACCAGGCGCTCCAGCAAGAAGGCCGCATGATGGTGCTATTGGGCgGaCGCTCAACGTCGTGCATTTCTTCGGGGCgTATGAAGAT
GACGAGAGTGTCTATTTGGTCATGGAGCACTGCGTTGGAGGAGACGCCTTCGCTCGTCTCTCGCAGTCCAAGCACGAGCATAACGAACCGCTCGTGGCGA
TGTACATGACCGACATCTTGCATGTTGTATGGCAGTGCCACCTCCTACGGATTCTCCATGGCGACCTCAAACTCGAGAACTTCCTCTTCGCTGACTCGAA
AGATACCTCGCCACTCAAACTCACAGACTTTGGAGGCGCCTCATTCCTCAAGGAAgGGGAAACGCTTCATGAAGTGCGTGGCACCCCTCTTTACACgGCG
CCGGAAGTGCTAAGCCGTTCCAAGGACGGCTATTCGTTCCCATCTGATATGTGGAGTTGCGGTGTCATTCTCTATCGCTTGCTGGCGGGAAGATTCCCCT
TCGAAGGTGATCTCCTGGACGAGCGTATCATGATGGAAGAtGTTGACTTCACTTCCGCTCCTTGGTCCCATATCTCTGCAGACGCCATCGATCtCGTCCA
GCAGCTCCTCACTAGGGACgTGAACAAGCGGATAAtTGCTGAACAGGCACTTCAGCATCCTTGGATCCTCCGGCATTCGTTCACTCACAGCCAAGATGAG
CTGTCGGCTTCTCCAGCACACCTAAATGGCACGATGGTTCAACGGCTTCAACTTTACCGCTCCCTCAACAGCTTCCAACAAGCCGTTTTCACGGAGATTG
CTCGTCTTCTGCCGTTGGCAGTGAAGGAGCACATCGTCGTGCTCTTCACGGAGCTCTCTCGGCATGGCAGTACTCAAGTTGGTATCGCAGAGTTCGGCAC
CTACTTAACGAACGCTGGGTATCGCCTCACGCAGGGCGAAGTCAAGAGCTTTCTTCGTGGTCTCGATCTCGACGGCGACGGGTACTTGTCCATAGACGAG
TTCTGTGCAGCGTTGTTGGACTGGTCGGTGATCCAACGCGAGTgcCCTGAtcGtTGGAGTGGCATCGTCACCCAAGTGTTCGATTCCTTGGACCAGGACG
GCGATGGCCAACTGACGCTCGACGACTTGGCGCGACTTGCCCCCTTTGTTGACGATTCGCGCTTCCGCTACTCGTTTCGAAGCGATGTTAAGCGCTGTTT
CCAACACGCAGATCTTAATGGCGATGGGTTTATCGACCGCGAGGAGTTTCTGGCCATGCTGCATATCCAACTACGAGCGTATGAGCACTACGCGAGACGG
CTGGCGCCTCGAATGGGTCtCTCATGA