Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_134-fgenesh-gene-0.4
Orientation:
(+)
Number of Exons:
2
Description :
Protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
cAMP/cGMP-dependent protein kinase3.1PR00103
cAMP/cGMP-dependent protein kinase3.1PR00103
cAMP/cGMP-dependent protein kinase3.1PR00103
cAMP/cGMP-dependent protein kinase3.1PR00103
Profile scan predictionP-Valprediction_id
Cyclic nucleotide-binding domain20.535PS50042
Cyclic nucleotide-binding domain17.684PS50042
Cyclic nucleotide-binding domain7.925PS50042
HmmSmart predictionP-Valprediction_id
Cyclic nucleotide-binding domain3.2SM00100
Cyclic nucleotide-binding domain0.071SM00100
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclic nucleotide-binding domainIPR000595
*** None ***
InsideOutsideTMhelix
1-600
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
cAMP-dependent protein kinase regulator activityGO:0008603IEA
cAMP-dependent protein kinase complexGO:0005952IEA
*** None ***
*** None ***
Sequence
        2344 bases(100 bases per row)
AAGgACCGCATGTtCAAaGACTTCAACCCGGTGCAGCGGAAGTTTCTCATTGAGCgaTGCCAGCTGGAAGCATTCAACGATGGAGAGCTCATCTGCCGGC
AGGGAgAACTGGACGATCGGTACTTCATCCTGGCTGAAGGGGAGgCACAAGTGTTCGTTGAGGACGGCGGTGCTATGACGCTGGTGGCCACTAAGTCACT
GTTCCAGAGCTTCGGAGAGATGGGGCTCCTGGATAAGCCTCGCACTGCAACGGTTGTCGCCACCGGCGCCTCAGTGCTGTGCATTGTCATCTCAcGCAAG
CAgTACATCGCAGCTGCACAACTGTCGGGCACTGGTTCGACGCTCGATGTAGACGCTGAGGCCTTGCTGGCGACCACTCTCATTGAAGAGTGGAATTTAG
TGATCAACGCTCGGAACCTGCACCTCTCCAACCCCcAAGTGGCGCACTATCTCGTCACTTTCATCAAGAAaTTCAAAGCAGCGTACAACCAGAAGTTCGT
AGGACGTACGCTTTACCTCGATCTCTTCCGCCGTCTTCACCGAGAGCCGTCGCTCACGGAGGAGTTCGAGTTCCTCACATCTCGAATCGCGTGGGATTCC
CCAGCGTCATCGCTTGGAATCATCCGGTCGGAGACgAGGCGTGTGCTGTCCAaGCAACCAACGGATCGCTCCGCTGATGAGACCTCGTTCATCGGTCGTC
TCATCGAACACACGGCGTTTCtATCGAAATTCGATGTCCCTGGCCCGCACGTAGATCGATACAAGCTTGCGAGATGCCTCGCCAAGGTCGTGGTGTTCGC
CAACaTCTCCAAAGaCGCTTACcTCTTCCGACAAGGCAAGATCGAGAgTCGGGCTTtCCTGATTCTGCGAGGCAAGAtcAACATCGTGAACGAAGATGTA
AGTGTCGCGAACAACATGATCAAGCACCATGAGGTGCTAGCGACCCTCTCCGCTGGCGACTCGTTCGGCGAGCTGAGTCTCGTGACGAGGCTGCAGCGCT
CGGCCACCACTGTGGCTGGTTGTGATACGGACTTGCTCGTGTTCGACCGAGAGCATCTGCTTCACGTTCAGTCTGCTCTTCCTGGTGTGTCCGTGCAGCA
GGTGATGGTGCAGCGAGCCGAGTTCTTGTCGCGGTTGAGCTTCTTCAAAGGCAGCGATTTCGGACAGTGCATCCGTGTGGCCCACGACCTGCAAGAGGCC
GTGTACGACGCTCGCCATTTGTTCATGCAGGATGTAGCGCAGCAGCGAACGCTGTTCATTGTCAAGAGTGGGGAGGTCGCAGTCTTCATGAAGACACGGC
TACCAGCCGACTGCACTTCGGTGGGCGCTTCCCAACCAAAGCCGGCACTCGTTCGCGTTGCGACCATCGGGGCTCAGGAGTTCTTCGGCGTTGCAATTGC
GACGATCAACATGGGCCCCACATCATCAGCACCTCTCTCTTCCtCGTCTGCGGCGCTGCCTTCGCTATCTGCATCAGTACCTCCAGCGTGTGATTTGGGT
GCCGCCGTGTACATGTGCAcgTCACGAGTCGTCATATTGGAACTGTCGGAGCGAGggTGGCGTCGCTTGTGTCCACAGAGTCTCGTCATCATCCGCAACG
CCCTCATCGAGAGACACAAGTGGAACGAAAATGCCGCGCGGCAaGTCACAGCCAGcGGCCAGCACTACTACCACgTTGACCGTCCGTGGCAGCAaCTCAA
GGGAAGTTCGAGTCCAGGACGCTGCAGTACCTCGACGATGAGTGGCGTAGGTACCACCCAAGGTTGTATCACACCCAGGACTGCATCGCACTTGGCTCGC
CATCTCGTCGAGAAGCAGACTCACAGGAGCACCTACGCTGCACTCTTCTCTCCAGGGCCTGTTGGCGCCGACGGCACGACGGCGACGAAACCcAGTCGGG
CGTCAGAGATTCGCGCAGCAGTTCCTCTCGGCCCAAACTCTGCGGCTTCCACGAAGGCTCTGgggTGGgACATGGGCTTGAACTCTCCAAATGCTATGTG
TCCACCACACTTTGAGCCTCCCGTTCCCAGCCTCACGCCGCTTATCACGTTTGGATCTTGGACGCCGCCGTTGACATCTCTACTACCTCCATCCTTATCT
CCACGCACTGCACCCTTACTGCTTCTCACCACAAAGAAGGATCAACGCACGAACAACCAGGCGACGACACAGCACAAGGTCAACGCTGCGGAGGACTCTG
CATCTCTATGGAAAGCCAGGTCGAATCCACGAAGACTAGTCGAATATCAGGCACCATAGCTtcTGACCTCGCTATTTCTAGATGAAGGGGAGCGGCCAGA
TCCGCGTCTCGAGTCTCGACGACACCGCCGGTGCGTTGGGCCAA