Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.58
Orientation:
(-)
Number of Exons:
1
Description :
WD repeat and HMG-box DNA-binding protein 1
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40 repeat12.346PS50082
WD40-repeat-containing domain11.603PS50294
HmmSmart predictionP-Valprediction_id
WD40 repeat4.9SM00320
WD40 repeat43SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1024
*** None ***
PositionContextScore
942SSPRAKR|AP0.677
973TKPRIER|SV0.609
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3075 bases(100 bases per row)
ATGGACACCATGAAGCAGATCACGCTCAACGCTCCCGGCGTCGGAGACCTaGCGGTCTTTCGCACTGCCCGGGCGCTGTCGAGCTCGGAcGATGGTGCAG
CCGGCCACGAcGTGGCGGTGACCACGGGCGAGGATGGCGTTGTGTACTTTGTGGACATCAACACGGAGAAGtCGTTTTTGGATGCGGTTGTTTGTGATGG
TACGATGCCCGCGGTGGCCGTCGTGCCTGAGCAGACGCACCTGCTCGTCGTCTCGGGGGATGAGAATGCGCTGTACTCGTATAAGATGCCACCACAGTTT
GAACGGGACGCGCTGTTGTTACGcTCCCCCGTCGCGATCCGATACGTTGCCTGCAGCGCCAAGTAtATTGCCGTTGCGACTGAGGACACGGAGATCAAAG
TgCTGCGTCGAGCGGCAACAGATCAGATCATCGCGATCCAAGGTCATGAGCACGGCGTCAAGAGCGTGGCGTTTGATCCACGCGATGACCGTTTCCTCTG
CTCGGCCAGTGAGGATGGCACGGTTCGCGTCTTTGAATTGAACGAAGAGGcCAtGAGTGCGACGCAGTTGGCCGTCTTCAAGGTGCAGTATGGCGATATC
CGCAGTGAAGAAGTGTTCTGCCGATGCGCCTGGACGCCAGACGTGCTTGTTGTCCCAGTAAACCAGAGTATTCTTGAGCTCTTCGACCGCACGACATGGA
AGAGCAAAGGCCAACTGATGCTCCCCATTGGCAAGAGTAAAAGTGCAGATATTAACATCCTCAGCGTGTCGCCGAATGGTCTCTATGTGGCTGGAGCAAC
TCTTAAGCAGGAGGTCTTCGTTTGGAACGTGTCGAAGAAAGAGATCGTGCGGTCCTTTCGAGTCGAGCATGACATCGTAGCTGTCCAGTGGGCaGAGGGC
CAAAATACTCTGCTTGTCTTCAATAATGGTGGTCGTCTCGGATTCGTCAAGGACGTCATCCCGATGGGGCTCACTcCCCCGCACAACACGGGACTTGGTG
CACAAACGACGTCGAGCGTCGGATCGACTGCCCAGAAGAAGACTATCGAGAAGCCCAAGAAGAAACGCTTGAATGCCTCGCAGTTTGTCGATGATGAAGC
CGTGGTGGACGGTGATGACGGCGACGATGATGATGATGAGGAAGCGGAACTGACTGGTGTGGAGGCGATCAAGGCCAGCTTTGGGTTTGGATCAGCTGCC
GCAAGCGCAGACGCCGACCTCGGTTTGTCCACTGAGAAGCTTGATGACGAAGACGACCAGGATGTCGAGTTCACGAGCAACACGTTTGCTCGTAACACGG
CAGCAGCATCGCCATTCCAGACTTACCAGGAACCATTCCAGTCGGGTAGCGTGACGGATGGATCCGTgTCTCTATTGGCATGGACGCCACTAGGAGAGAT
TGAGTGTATTCGCGGTGCCAGCCGAAGTGAGCATCTTGTCAAGGTCGAGTTCGCTGACAAGTCTCGACGTGGCTTCAAGTTCAGCGACAATTACCTCTTC
TCCATGGCTGTTTTGGACGACCGCGGTGCCTTCTTCGCTGTTCCACGTCGCGCTCGAGAAGACTGGGATGATAGTGTGATGAATGACCACGAGAACGGCG
ATATCATCAGCAGCTTCATCTTCTACCGTCCGTTTGACTCGTGGGCAAGTAACTCGTCgTGGCACTTGGACCTGCCCGAAGGCGAAGACGCTGAGAGCAT
CGCAACAGCACAGGAGTTCTGCGCTGTGGCCACATCTCTCAACTGCCTTCGCGTGTACACGACTGGTgGGaTCGCGTTCGCGCTCCTGCGTCtTcCAGGG
CGTGTCGTTACAATGGCTGCACATGGGTCGTTCTTGGCCGTgGTCTACCAAGACGGAGTGGCTCGTCTCGGtttcAAGATGTTTGACATTCGTGTGACAC
CAGACGCTGACCGAGTCCGAGTACTTGCAGAAGGGGTATTGCCACTTACgCCACCAATTGTGGAGGTATTCGCAAGCCATaAAGAAAATGAGCAGGCCCG
CCGTgaTATTTCACAATAcCCGACCCTGTCGTGGCTCGGATTCGACGAACGAGGAGTTCTCTATGCtgTAGActCCTTTGGCTGCGTGCAGGCCCTCGCC
AAGAGCTACGGTTGGCAGTGGTTCCCACTGGGTGTCGTGGGTAACGCACTGTCAAAGAAGCCTGAAGAACGCCCTCGCATCTTCACACTCGGTGTCGTCA
ATAATACCCTCCTTTTCTTCCCCCTTGAGAAGGGTGCATCGGGCCCTCGtCTCCGAGGCAAACATCGTCCTGTGCCTCTCAAGTTCGCGCTGCAGCACGC
TTCTTTCCCAACAACTCGTTCTTCGAAGGGTGATGGTGCACCTCCAGTTGTGAATGATTTATGGCaACAGGtTcGTCTGTCCGCCCTAGACGACGCCGAC
ATTGcGACGGAAGACAAGAGAGTGTTTGAACAAGCCGAGATGGACAAGTCGCTGATCCTTATGATGAAAGCAGCATGCACGAATGACGAACCAGCACGtg
TTCTTGACTTAGCCAAGTGTCTCCACCTGGAGAAGTCGCACCAGATCGCCCAGAAGTTGGCCgTACACTTTGGTTTCCGTGCATTGCAGACACAGCTTTA
cGATTTGTACCGAGACCGCTTCGAGCGAATGGAACGTCACGCTCCAGCAGTGTCGCACCACCCACGGCATACATCTCAGCCaACACAAGCTGCTGAGCCC
ATGGCGTCACGCCCACAGCCAAGACTGGCGCGACAGCCGAAGCCTCAACCACCAACAGAGCACGATGAACCGCAGGTGCAGGATGAAAAGGCTACGTCGG
CACCTTCGTCTCCTCGAGCGAAGCGAGCGCCGGAATCCGCAGAGGAGAGTCTACGAGCAGAGGAGGACAACCACGCGCAACCGAGCAACGTGACGACGAC
AAAGCCACGAAtcGAGCGATCTGTTGTTCCTGCCAACCCGTTTCTgaAGAAGCCgaGTCCGAAGAGCAATGCGTCGTCCGGAGCCGATAGCAAGAAGAAG
ACTGCTGGTGGTCTTGAGCGACTCGCTAAGTTCACTTCGCCGCCTCCAGCAAAGCGTCCGAAGCCATGGAAGTAG