Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_43-fgenesh-gene-0.10
Orientation:
(+)
Number of Exons:
2
Description :
3-hydroxy-3-methylglutaryl-coenzyme A reductase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Hydroxymethylglutaryl-CoA reductase, class I/II25.244PS50065
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-960
NN-scoreoddsWeighted Score
0.5611.3160.003
PositionContextScore
371CMQRRAR|ST0.578
685SEMREER|ST0.511
TypeScore
cytoplasmic304
GO
Biological ProcessGO IDPrediction Method
hydroxymethylglutaryl-CoA reductase (NADPH) activityGO:0004420IEA
KO ID
K00054
*** None ***
Sequence
        2945 bases(100 bases per row)
ATGATCGACGTCCAGAGCCCCGCGGCGCTTGTGTGCGCCAACGACTTCAACGAGTCGCTCGACCGCGTGCTGCTCGCGAGCCACGCACTGCTCGACGCAG
CCACGCGCCTGAAGACGCTGCCGCAGGACGGTAGTGTCgTGAAGaaGCTCCAGGAGCTGTGCAaCACGACGACCAAGCTGCGCGATGTCATCCAGCAGCG
CCCAGCGgTGGACGAAGCCGCTGCCGTCGTGACCAAGCGCTTtGATCCGCTGCAGCCCACGCCGCCGGCGACGCTTGACGAcGGATGGGGTGCTGCCAAT
TCAAGCCAATCGCAGCCATCAGTCTGGTCGGgCTTCTACAACAAGACCCTGCGCGAGCGCTTCGATGTGCTCTCGCTCATGTACCCAcGCCTGCAGCGCG
TGGTCAAGCATGATGCGGACGAGGCGTTCGCCATGGACAAGCAGCCGATTCTCGACGCCATCAAGCTCGGGGAACTGCCTGTGCGGACGGCGAACCTCAT
GATTGAGAACTGCATTGGCGTGCTGGGCATTCCGCTCGGTCTGGGGCTCAATTTCCTCATCGATGGCAAGCATCTCTCGGTGCCCATGGCCGTGGAAGAG
CCATCGGTGGTCGCGGCAGCATCAAGCGCCGCCAAGCTCGTGGCCTCATTTGGTGGCGGCTTCACCACGGCCACGACGGGCAACATCATGACCTCGCAAG
TACAGCTCGTCGACACCCCCGACATTCCGACGGCGATCGCCGCCATCGAGGCCAACAAGGATCGACTGCTGCACATTGCCAATACGACACTGTGTCCCAA
CATGAAGAAACGCGGAGGTGGGGCCATCGACGTGTACTGCCGCGTTGTCACGCAACGCTCTCGATCGGACCATACGCACTCGACCAGTGGAGACTACTGG
TATGCCAAGTGTGACGACGAACTGGTCGTCAACGCGTCCGACGCCGACGTCGAGTACTTGGTCGTGCACATTGACGTTGATGTGTGCGAGGCCATGGGCG
CCAACATCGTCAACACGGTGGCCGAAGGCCTGACGAATGAGATTTGCCAGCTGACCAAGAGCCGATGCGGCCTCCGTATCCTCACGAACCTCTGCATGCA
ACGTCGAGCACGATCAACATTCGAGATCCCAGTACAGAAACTCGGATGGAAGGGAGTGGAGGGCGAACAGGTCGCTCAGCGCATTGTCGAAGCATACAAC
TTTGCAGCCATCGACCCATACCGTGCAGTCACCAACAACAAGGGCATCATGAATGGTGTGGATGCCGTGGCACTGGCGACTGGGCAAGATTGGCGTGCCA
TCGAGGCGGCTGCTCACTGCTACGCGAGTCGTTCGGGCCAGTACGCATCGCTTTCCAAGTACGAGATCGTCGAGCGGGACGACGGCAAACGCGTGTTGCG
AGGCAGCTTGGAGCTTCCTATCTCCGTGGGCTCCAAGGGCGGTGCCCTTCAGACGCATCCGGGCTACCGCGCTACTCACTCCATCCTGGGTCAGCCCGAT
GCTCGCAACCTGAGCAGCATCATCGTGAGCGTTGGCTTAGCTCAGAACTTTGCGGCCATTCGTGCCATTGCAGTCACAGGAATTCAGAAAGGTCACATGG
CATTGCACGCCCGCAACATCGCTGTCGCTGCTGGGGCTCCAAGCGAGCTTGTGTCAGAGGTTTGCACGTACATGCTCGGTCGCAAATGTATCAACGTTGA
GACGGCCAAGGAATACCTGCACGCCCACGAGGTGTTCTCGGAGATTCACAGCAGTTCCCCACCACTGTCACCGCAGCATCAGGTGCGAGAGTCACCACTG
CCGTCGATGTTTTATGTCGAGATCCCTGTGCCTCATCTCGAAGGAGCTGTGAGTCTCAATATTGCATTTGAGTCGATCAACAAGCACCCGCAGTACATTG
CGATCCAGCCCACAGGCCGTGATGGCGACAAGAAGGAGCTGTCGGTCATCCAGCGTCAGCtCCTTGGCGACAAGGGCTACAACCAGCTCGAAAAAATGTT
CATGTTCCTGGCCTCGATGCGGTCAATTGTGATCTCGGAGATGAGAGAGGAACGATCGAcTtCGAATGAGGACGAGAGCCCCATCGTGATGCTGTCTCGT
GCTAATTTAGCGCTTCAGAACAAGCTACAacTGCTCTCAGTGCTCATCAACATCCTCGTGTACGTTTGATGGAGGTGCGCTCAGCTGCGGCCGGTGCGTT
CATGCgTGAAGTGCTTGCCAGTGGCtcGTCCCTCAGCGATCTCGATGCGACACGCTGTCGTCTGCTGCTGAGCGACGTTCCACCAAGTGACGATGTGCTC
TCGACCGGTCTCCCGCTCTTCCTGGCTTTGTGTCAAGTTCTCAGCTATCATCTGGACCAGGATgTATCTCaCAAACTCGtGCGCGAGCGAATGGCGACAG
AGCAgTGGACGcTACTACGAGCAGTGGtGCACAGCTTCGAGCTCGTCAGTGGGCCAGTCAGTGAGGCAACAGACCCTGACGACAAACTGCTAGCGTTCAT
GGCTATTCACGCCAAGCGCTGGCAAGCGACGATGCTGCTCCTCGTGGACACACTGGCAcTCCCATCGGAGATGGTTACGCCCTCGCGCCTCGATGCCCTG
TCCGCAATCGGTGAGTACATGGAGTGGGAAGGCACCGTCGCCCACGACATCGCACGATACACCAGAGCTGTGGCCGAGCGGATCCCCAATGCCTTTGTGT
ATTGGTTGCGCCTTCACGGATACGACTGCGAAGCAGACAACGACTCTGGCAACCGTGTGGACGCCTTCCGTCGTGTTGCGGACGTGTCGGCGCAGAGCAA
GTGGCGTGTCGTGGAGCAGAAGCTGGCGGCCGACGTGGAAGCGAGAAGCGTGTTCTCTCTGTCGGCGGTGACTCGGGTGACGCAGATGGTGCGCGACGTG
TATGGAGAACGCAgCGGGCGACGACCACGCGAAGActCGTTCTAG