Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_3-snap-gene-0.31
Orientation:
(+)
Number of Exons:
1
Description :
TRAF-interacting protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, RING-type12.637PS50089
HmmSmart predictionP-Valprediction_id
Zinc finger, RING-type3.6SM00184
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-470
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        1413 bases(100 bases per row)
ATGCGCTCGACCTCGTCGGCAGTGGAGGAGGCGACTGTGGCGACGGCGGCGTCTCCGTCCAAGACCCAGGAGTGCCATATCTGCCTCGAAGACCTACGTA
CAGAACTCGCCGTGTGTCCGTGCGGCCACGTGTATCACGAAGAGTGCATCGCACAGGCTCTGCAAGTCAATGAGCAATGCCCGATTTGTCGCCGGTACGC
GACCGCGAGAGGAGTTATCCGACTGTTTCTGGAAGTCCCCGAGACGCACGCTGGGAGCGGCGCTGATGCAATTCAgaCAGCGCAGGATGCGATGACGAGC
CAgAaCCCaCAGGTGGCGAGGTTGAGCGAGCGCATCGTCGGTCTTGTCGACCGCATACAGCACCAGAAAAAGCAAAACGAAGCACTCGCTGCAGAAATGA
AACGCGTCCGACACCAAACAGAGCAGCTGATGGTCGATAAACAGACGCTGATGCAGCGCATGAGCATGCTGGAAGCTAGCAAAAATGAACTGCAAAGTAa
aGTGGCCAAGTATCAAATCGAGCTGAGCCGACAGGCTGAGGCAGCACGACAAATGGCTGTCAACCAGAGCATCATCAACTACCTCAACTCGTGCGACAGT
GATGCGTTAGAAGACGACATTCAAAACCCACGAGAGCTCGTTGTTGCACTCAAGAAAGCGTGCAAGTTCAGACATGACCAGTATCAAAAGGCAGTTAAGG
AGAAGGCGCGACTCAAGTCCATGGTGCAGTCACTTCAGCAGCAAATCGGCATGGGAAGCTCATCTTCGGCTTCTATGATGGGCCTTGACCAAGATCGAAT
GTTGAAAGGCAAAATGAAGAATCCCATGGAAACGAAACGAGCGTACTCAGCAGCAGACTATTCGACACCGCACGGTATGGAGTACAAGAAGCGCAAAGTT
ACGATCTCGCCGGTGGGAGGAGTGGGTTCCCAGGCTCTtCCcTCGAACTCGTCTTCTTCAGCACCGTCTGGTTTTGTTTCTCGtACCGAACCATCGAGTT
TCCGATCAATTGCCTATACTGACGTTAGCACGCGTCCAGCAACGACAAGCAATCTTCCACGTGGACACCCCGGTGTCGCTTTCTCACGCAGCAGTTTTAA
TCCCAGTCAGTACGGATCCTACAATCTCACTCCGTCTCACGAAGCACCAGTACAAGCACCAGATGGAGCAGTCTGTCGTCGTGGATACGACGAGACTGGG
AAGTTGACCAACTATTTCATCCCAAAGGACACGAAGCGCTCGTCGACCTTACATGTGCAGAACAAGACGCCTATGCAGCATTATCTAAGCACAGCACCAA
ACCACCACAACCGAGGTTCAGGGGTCCAATcTtCGAATTCTGGGGTGGATCGGTCGGCGGCTTCGAGCGAGCGGCatGAGTTCCCCCTCACTAGTTGGCT
TCGTAAGGGCTAG