Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-1.34
Orientation:
(+)
Number of Exons:
3
Description :
DEAD/DEAH box RNA helicase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA helicase, DEAD-box type, Q motif8.002PS51195
Helicase, superfamily 1/2, ATP-binding domain28.787PS51192
Helicase, C-terminal22.967PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain1.1SM00487
Helicase, C-terminal2SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
RNA helicase, DEAD-box type, Q motifIPR014014
Helicase, superfamily 1/2, ATP-binding domainIPR014001
*** None ***
InsideOutsideTMhelix
1-661
NN-scoreoddsWeighted Score
0.5761.5890.003
PositionContextScore
80SKPRRKR|KL0.748
81KPRRKRK|LS0.51
121NRKRKKR|SA0.891
TypeScore
nuclear913
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
*** None ***
*** None ***
Sequence
        2180 bases(100 bases per row)
ATGGCGAGCTTCTTCAGCACGCTGGCGCGCGGCGTCAAGTTCGATGCGCAGCGCATCCGGGGCGCGAAGCAGCACTTCAAGAAGGACAGCGAAGGCGCCG
CCAACAAGAGCAAGCAGGCGGCGAGAGAACTCGATTTTTtCGGCTTTGATGCGGTGCAGGCAAAGTGCGTGGTTCAAAGGaCTCGCGGAAGGCATGGAGG
AACTGATGAGAAGTGTGTGCGGTAGGAACAAaCCCATGGAGACCAAGACAGCCAAGCGCGAGCGGAAGATCAGCGTGGATCTCGTGCCGAGCTGGGCCGG
GAACGAGTCGGACGGAGCCAAGAAGCAGAaGAAGAaGAAGGAAGGGAGCAAGCcAcGCcGcAAGCGAAAGCTGAGTGAAGGCGCGATCGAAGAaGAACGA
CTGgCGgAAGAaGAACGGCGACaGGCGTCGATGCTGCTGGCGCCAAAGCACGACGGCAAGAGCAAGAAGAACCGCAAGCGGAAGAAGCGGTCGGCGTCGA
TGGGCAGCGAAGTGACGGAAGATGACGAAGAaCAGAACGgAGAaGAAGAAGAaaGTGAGgATGAGGAAGACGACGTGGATCtGTTCAAGAATGGGCGCGA
TGAAGACAACGGTGGCGCGAAGAAGAGTGCTAAGAAGCAGGCCAAGAAGGACGCCAAGGCCGAGCGCGAGATGGAAGAAGTACGACTCTTCCGCAAGCAG
ATGAACATCCGTGTAGAGGGCACGGGCGTGCCAGCGCCCATTGCGACGTTCGAGGCCATGAAGCTGAGCAAGACGCAaGAAAAAATGCGTAGCGTACTGC
TGAAGAACATCGAAGCGTCAGAGTACAAAGAGCCAACGCCGATTCAGATGCAGTCCATCCCGAGCATGCTGTCGGGCCGTGAAGTACTTGCAACTGCTCC
CACGGGCTCTGGTAAGACGGCTGCGTTCGCGATCCCGATTCTCGCGAACCTGGGCATGCCCAAGCAGGAAGGCATCCGCGCAGTCGTCCTCTCCCCCACA
CGTGAGCTGGCCGTGCAGATCCACAGCGAGTTCACGCGTCTGTCCGCTGGCCGGAAGTTCCACATCGTGTTCCTTTCCAAGGCTACGGCTGCGACAATGA
TCTCGCAAATCAAAAACAACTGCACGGTGAACCACGACATTGTGATCGCGACGCCGCTGCGTCTCGTGCATCTGATCCAAGAGGCCAAGCTCGACCTCTC
GATGGTTGAGATGGTGTGTCTCGACGAAGCCGATCGCCTCTTCGACATGGGCTTTGTGGAACAGATCGACGAAGTGTTAGCTGCATGCAGTAATCCGCAT
GTCCAGCGAGCTATGTTCAGCGCCACGATGCTGCAAGGCGTAGAGGAGATGGCCCAGTCGGTTCTGCGAGATCCTATCAAGATCTCCATTGGTGTCAAGA
ACGCGGGTGCCACCACCATCGAGCAGAAGCTTGTGTTCGTCGGCAAAGAAGAAGGCAAACTCGTGGCTATGAAGCAATTGATCCAGGAAGGACTCAAGAT
TCCGGCCCTGCTTTTCGTGCAGAACAAAGAGCGTGCCAATGAACTGTACCATGAACTGCTGTACGACGGCATCAACGTGGGGACGGTGCATGCTGACCGT
ACGAAGGAGCAACGTGACGAGACCATGCGGCAGTTCCGCTCGGGTCAAGTGTGGGTCTTGATTTGTACCGACCTCATGAGCCGAGGTATCGACTTCAAGG
CCGTCAACATGGTGATCAACTACGATTTCCCTCAGGACGCCGTGAGTTACATTCACCGCATCGGTCGTACGGGTCGAGGTGGCCGTCAGGGCTACGCTGT
GACTTTCTTCACGGAAGATGACATGCTCTACTTGCGAACGATCGCCAACGTAaTGAAGTTGTCTGGCTGTGAGGTGCCTGACTGGATGCTGAAGCTCAAG
AAGGCCAGGTACGGAAATGCTGACTGTAACGGGGTGAGACCATGATAAACTGACCGTGGCTGATGAATAACACAGTGCAAACAGACGCAAGAAGCTGGTG
AAGGCGCCGATTCAGCGCAAGCGAATCAGCACAGTCTCGGGTTATGACCTTCAGAAGCAGCACAAGCGACAACTCGTCAAGCAGAAGTCCAAGGGCCAGG
CGAGCGATGAGAGCGCCGAGGCGCAGCCAAGCGGGTCTCAGCCGGCCAAGAAGACGCACAAGGCGCGTACTAgTGCATAG