Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.32
Orientation:
(+)
Number of Exons:
2
Description :
Calmodulin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site7.748PS50096
WW domain12.117PS50020
EF-hand domain13.398PS50222
EF-hand domain12.784PS50222
HmmSmart predictionP-Valprediction_id
WW domain2SM00456
WW domain1.2SM00456
EF-hand domain0.0065SM00054
EF-hand domain0.025SM00054
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-368
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
calcium ion bindingGO:0005509IEA
*** None ***
*** None ***
Sequence
        1161 bases(100 bases per row)
ATGACAGCAGACATCATCTTGCTACGAGGCTCAATAGAGCAGCAGTTGCCGTTGTTTGGAGTCAAGTGGGAACGAAATCACGTAGTAGAAATTGACCTCT
CTGCGAACGGCTTGAGCGGCAGATTGACAAAAGAAATCTCGTCTTTGCGCAGCTTGAAGATGCTCAAACTCAGAAACAACCCACAACTGCGAGGCCAACT
CCCAGCAGATCTGTACCACATGCCACAGCTTCAGTACTGCTACCTTGATGGAACAAAGCTCGAGTCACTGCTCCCTCATCATGAAGCTTTTAGCTTCCAA
ATCACTCGTCTTCACCCAGAGACCACGACTACACGAGGTATTGCTTCTCCAGCCGCCAGCATAGTGTTCTCTACACTCAATCGAAGCGGTGGGCAAACCC
GGTGGGTAGCTGATATGAGTGAGACTGAGTTGTATATGGTGCACTCTTCACTCAAAGCACGCCACGAGAAGGCTCGGCAGGTTGCCAACGCTGAATCGTC
TGGGTGCACTGCATCCAATGCTACTGGTCCAGAACGaGTTGCAGCTGCTGTGAAGCTtCAGCGTATTtACCGTGCTCGCATTGAACGAACCAAGTTCCGA
AACTTCTTGAAGTCGCTTTTCGAGAAGCACTACGACTTGACTACGGGGTGTAACTATTTCGTCGACAAACGCACAGGGGAAGCGATGTGGGAGCGACCCA
AATACGTAGCGAAGACCCCCAGAAGCACAGTCGAATACTCTTCAGAGAGCAATCAAGATGTGTGGCAAGCATTCGACGATGGAAACGGCTACACGGTGAG
TGGACGTTTCTGGAATGGCCTTAgTGGGAGCTGATCTGTCATCTGTCAGTATTACTGGAATCGACTGACTGGAGAATCGACgTGGGAACCGCCTGtGTTT
CTCAGTCGTATCTATCAAgAGTTGCGTGATCGTTACGGCAATGCTCACAATGATGAAGAGCGCTTTGACTTGTTTTTCCGGAGCATCGACAGAGATAACA
CTGGTTCGATTGATCGGGATGAGTTTGCTCGCCTGTGTGGTGAGCTGGGAATGGCAATGTCCCCAAAACAAATCGACAAAGTGTTCGATGACCTGGACAC
AAGTGGGGATGGGCAGTTGAGTCGAGAAGAAaTCATCGCTTGGCTTACTCGCAACTATTAG