Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-1.38
Orientation:
(+)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
83-102
236-255
325-387
1-59
126-212
276-301
411-719
60-82
103-125
213-235
256-275
302-324
388-410
NN-scoreoddsWeighted Score
0.7142.8510.006
*** None ***
TypeScore
endoplasmic reticulum556
GO
*** None ***
*** None ***
*** None ***
Sequence
        2160 bases(100 bases per row)
ATGACGGAGCGTCAGCGATCAATTACCCCCGATGTTATCGTGGCCCCGCTGACGGCCGGGGCGTCAAAGATTCGGAAAAGCATGGCGCAAGCAGCTGCGC
TCATCACAGAAGAGAGAGAACCACCGTACCTCGCAGTTCGACTTGGCCGTGTTGGGTACACACTGAGCTGGAGCATTGTCTTCTCGTTCCACCTCTTCAA
TGCGCTGTACACGGCGGCGTTGGCTTATATCTACGTATTTCTACGCAAGCCTGAGATGGAATACTACATCTCACTCATCCAGATGATCCCAcAGGACAAG
TTCAAGTACATCACAGCACTTTAtGCAATCATCAGTGCACTCAACGTCCATCACGTTGTTAGCATGGTGGTCTACTCGGTTACATATCGTCGACTCGTGT
TTGAGAAAGATAAAGTTGGCAAAGCgAGGGTCACCGACGTGTTTGACAAGCACTCGAGACGGTTAAGACTGTGCATCTGCCTTCCCCAGGCGATCACAAG
TTTCTTTAGTCGTCTGAAGCGGTCTATGAGTATTCAAGGACACCTATTTGACGTGAAACTTCTGGTTCGAGAAATGGCAGAAGTCGCTTCACAGACATAT
CAGGCTCATTCTtCCAGTTTTCTTGTCAGCAAGATGTGGATCAACCAGCTCTTCGGCCTGCTTGTATGCCTAAACTGTGTGGCGAATACAGTAGTACACT
TGTTCAAGGAAGAGCAGACTGGCATGCGACGATTCTTATGCACTGTTATTGATCTTTTCCTCGATTTTGCTTGGGGATTTGTCTTCCCTGGGAATATTAT
CAGCACGTACGTCCCGATGTTTATTCGGAACAACTACAATCTCCCAAATGAGTACGCcACGAGCGATGTtCTGTATACGAAGGCCATGCTTGAGTGCCGG
CAACTCTTTATTGTCTCGTGGGCGGATGCTTTTACCACTTTAATTCCGTATTTCAACATGTTTGCGGGGCTGCGCAACATGAAAATTCTGCTTCAGATCG
ACCGCTCGCGTCATTCGTCTCCTCCTCGCTCGGCTATCATATCGCCGGCTCCAGAAGCTCAGCTCCATCCAAATGATCAATCTGCAGTTCGAAAAGGTCC
CAGATTTGACAGCATCCCTTCCATGCCGTCACGAAGACCAAAGCCACTGCTCCGGCGCATGGGATTCATGCTGATCCTCCCAATATTCGGAACCTGTGTG
CTTTTTGCTTCGCTCCAAGCGTCAGGTTACTTtGGTCATGACACGTGCGGCGACGGCTGCAAACTCCGCATGCGACCTTGGTTCTCGACCCACTGTGCGT
GCTCCGTGCTCGAAATCAACTGTCATCAGCGACGCATGAATGATTCCCACGATGAGATTCAAAAAATCTTCGACGCCCTCGACCACCGCGTGCTCAACTC
GCTCATCATCACGCACTGTGGCGATTTTGCCATGCCCCACAACTTCCAGCGCTTCACATTTCTCCTTGGACTCGAGTTCTACAACGTCACTTTTGTCGAC
TGGCCGCGTGAGGCCGCCGTCTCGAACGCCTTCTTTCCCAATCTCAAGTATCTCTATATTGCACGTTCCAAAGTCGGTACGCTGCCCGAAGGCCTCACTC
ACGACACAACGAAGAGCCTCGTTGACATCGAGATCTCGGCCACTGATTTGCCGTATCTTCCAGAGGACCTCGACCAGAAATGGCCGAGTGTACTCATGTT
GTACGTCGAGTTTTGTGGACTGCGCGAGTTCCCAGTTGCCGCTACGAGGATGTCGCTTACGGATTTTTCACTCGTCGGGAACAACATCAAGGAAATACCG
GAGGACTTGCCCGAGGTAGCCACATGGATGTACGTGTACTTGGATCGGAACAAACTGCAGCGACTGCCGGACCGGATCGGCGGGTTCCCGAGTTTAATGA
CGCTTACACTTCAGCTGAACGaCATTAACGCAGTGCCTCAGTGGTTGTTGAACCTCAACACGCCACGAGTGATGCTGTGGGTGAGCGCGTTCGGCAACCC
GATTTGCGTTGACAAGGACAACGCGATGACTCGGCCAGGTATTATCTGTTCCCAGCCCAACACCTTTGTGTGGAACGGCGCCTTCCCATTGCAGGACAAA
GATGCCAAGCGCCGCGGCGATTTCCCCGAAGAGTTTCTCGCATTCCCTGAATGGCAATAA