Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.54
Orientation:
(-)
Number of Exons:
4
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-966
NN-scoreoddsWeighted Score
0.6582.7230.005
PositionContextScore
396ALYRTRR|SK0.636
664RAMRRRR|EA0.534
TypeScore
cytoplasmic348
GO
*** None ***
*** None ***
*** None ***
Sequence
        3067 bases(100 bases per row)
ATGGACAACTTCTATCATGGTGCTCACAATGATATCATTCTTCGTGATCCTAAATCACTAGAGAATCTGCTTCTGTCCAATCTCCAAGTCGGTAATATCC
ACATAACCATTAGAAAGGCCACCGAGTTCCTACCACTTTTCGGTTCTGATCACGGATGTCGGTCGCAAGTGGAGTATGCTGCAAAATGCTACGAGTTTAT
TCGGTTTGTGGAGGAACTAAGCCCACTACTAATCGTCATAGTAAATCCAGACGACGTAGAACTGCCCATCGGGACCTTTGAAGTCTCTATGGAATTGTGC
CGTTCACCTAGCAGCGCGTGCGTCTCAATTTTGCTTCACTCTATGCAAAATACTTCGTCTTTTCCAAGTCGGAAGGACATCAAGGCGAAAATCATTGATG
TTCTCACACACGAAGCTCGAAGGTGAGTGTTAGCCGTGTGCAAATTCATGTTCTGACGAAGACGTAATCTTGTTGTGGCTGTGCTCTAAGATCACCAGGT
GAGGACGTTACGAAACAAGCACTTCGGTATTTTCTTTcTCTGGCACAACAATTTCGAgGTGGACGGGAGAGGCAGtTCATGGAATCCGTCATGAATCGaA
AAGCTGtTATCACAGaAAAACGaATCACGGAAGtTTTCCAACGAATAGGGtTCTATTTCGCTCAGTCTGAGCTACAAGAcCTCATCCGAGCCtTTaAGAC
GATGCAGGTaAgTaCCTCACATTCAGGCAACCCTcAAcACCAGATATGACCATTCATCTCtTTTGGGTCAGGATGGATTCtTGCGACAtCAGCACCGAAT
GGATGATATACCAACAGTCGCGCTTGTCTCGCCATCATCAACAGGGACGTATCATCTCCCTCTTGTTCACCAGCTATCGCTAACAGCGATAACGCCGTGT
GACCGaATTGTgGCGCAGTCGCCGTGGCGtTTTGtTGCTGTGTTTCTAAGtTTTGATTTACAACTCCTCGAGTTCTTGCATGACGGTACTCCCACATCGC
CATTTGGCGATTCATCATATTCTCAGTCACGCTTTCTTCATGGTGGATTCGTTGATCGGTTGGTTATTGACTTGACACAAATCCCAAGTCATGTCTATTG
CATTCTATTCAATCTCAAGGTGAGAGGTGGCCACGaAAATGGGCAAGTCAACACAGAAAGCTCGCAGTATTCTTGTCATCAGTGCAGTGTAAAATCaAAG
AATGCTATCCGAGTGGAGGTTGAGAATGGCGAAAACTTGCACCATCTTGTCCACTTTGAGGCACTTCCGAATCCAGAGTGCAAATGGTTCTGCCTTGGCG
CACTGTATCGTACGCGAAGATCGAAGATGTGGCGATTTCAAGCTCTGGGAGGGAGCCTTCAAGCAACAACTATTCACTCCAGTCTCGAGGAAATGAATGG
GCTTCTCGTTGATCGAAATATCGTTCCAGTGTATGATGTGATCGTTTCCTACCGAGATAGCCGAGACAGTGCGGATTTTTCCGATTTTGCCGCGCGCTTT
TCGAAAAACATTCGATTTGGTCGAAATGGGAAGATAAGTATCATGGCTCTAGGTGGATGTGTTGACCCAGAAACCCATGGCCACGAAAAAAACTCTCCTA
TGCTTGAAGTCTCACTTCGTATACAAGGGCACACCGAGAACATTGTCGTTTACAGATCCAATGGCAGAGAAAAAGCCCTACCAACTATCCAGAGTGTCTG
TAGAAGTGTTTTACGAGTGCTGTCTGATCATGGCATCAAGGAGAGCCTCCAGCAAAATCCTTTCGTTGTTGGTGTAAAGAAGGTTAAGCGTCCCGTTAAC
ATCCGGGTCGTTTCTGATGAGACTAATGCCCCAATCGCAAACGCCTACATCTTCGTTGAGaAGAGTCTAGACCACCAGAGTATCGTCACCAACCTAGCAA
GGAAGATTGTTCCAACATTGACGATGGGATCTCGCCTTGTATCTATTCGTAAACGACTTCAGAAAAAGAAGTATGTCGAAGAAGTAAAAGCGGCAGCACG
CAACTTCGTGGCTGAGGTGGTCGACCTCGGAATCAGATATGCTCTTGTAAGCCTCCGCGACGCGAAGTTGGTACCCATTGTGAAATCTCGTGCGGTTCTC
CGTCGCGCTATGCGACGAAGACGTGAGGCCATCATGaAAAAAATTCTAGATGCAATGAGTGAGAGTGAACGATCACGGATCTACTCGCGTAGTGGCCCTG
TCCGGCTCCAACAACTGTACTGCCAACAGTTGAACCTTTCGACCAGTGAGAAGGAATTGCTATCAGGTCTTAGTGAACTCGAGATTGACGAGATTAGGAA
AGAATTGGGTTTATCTCAAGAACCCGTACTCGAGGTAAATCCACATGCTTATGTAGAAGAAGTTTGGCAGCATCAACTTCAAGAAAATCGGTCAGTGATA
GCATTCCCAGATTCTCAACAGTCGCCTCATGATAATCGCAATCTAGCGAGACGATGTGCGTTCATTCAACCCCCAGTGAATATCATACCACGAAGCGGAA
AAACACCGAAGAAATCTTATCTAACGGACGAGAGTGGGCTAGTAGCCTGCAACCTGGCCCCCGGGTCGTATTCTGTGTATGTTTTTCACAGTGACTACTT
CGAGTGGACCTCCCTTACTGTCAtTTTTCCAACTGTGAACGCATCAGGCCTGTTTGGAAGCTCGCTATCAATGTCAGCGCCTCAAGAGATTGTTGCACCT
CTCGAGTCATTCAAGTGGTCGTATGGTATTCAAATCGTGGATTTCTACCAGCAGCACATCACCAAGCTTGTGGAAGGCGTTCCAGTGCAGATTATTGATA
AAGTCACCTTAGAGCAGACAATCTTCACCACGAACGCTGATGGTACCATTCAGTGGGATGTTCGGAAGGGTATCTATTCAGTCCGAGTACTCACTGAGAA
CACGTCGATCATTTACTCCGGTACAAAAAACGTCGTGGTGGATGGCGGCCGATACCATCCACCACGAACCATTTTCATCCCTGTCCTATTTGGAAAAGTT
GCGCTCGAGATTGCAGTTGGTCGGTTTCCTGGTCGAGTGGATGTTGCACTCCAAGACGCAGTTCTAG