Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.46
Orientation:
(-)
Number of Exons:
1
Description :
Telomerase reverse transcriptase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-95
NN-scoreoddsWeighted Score
0.6512.340.005
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
*** None ***
Sequence
        288 bases(100 bases per row)
AACTGACCCAGACGATGCAAATATCCTCACGCTAGGATATCGGGAGGTAACGCCTGGGTcCAATGGCCATCGCGTCGCGATAACGAACTCCGTGATGTGC
TACTATCCAAATACGCTTGTGGCAACGTTGAAAGAACCAGTGTGGGAAAAGCTTCACGAATTGGTCGGAGACGAGCTGCTTATTCATCTTCTGCTCAATT
ACTGTGTCTTTATGAAGACCCCGGGTCCAGTCATCAGTCAGGTGCAGGTATCAATTCGCTCTTGCTGCTGGATGAGGTGTGCGTTCTA