Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-1.29
Orientation:
(+)
Number of Exons:
1
Description :
Histone acetyltransferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Bromodomain2.1PR00503
Bromodomain2.1PR00503
Bromodomain2.1PR00503
Bromodomain2.1PR00503
Profile scan predictionP-Valprediction_id
Zinc finger, TAZ-type14.359PS50134
Bromodomain20.517PS50014
Zinc finger, ZZ-type12.433PS50135
Zinc finger, TAZ-type11.839PS50134
HmmSmart predictionP-Valprediction_id
Zinc finger, TAZ-type6.4SM00551
Bromodomain2.2SM00297
Zinc finger, PHD-type4.1SM00249
Zinc finger, ZZ-type3.2SM00291
Zinc finger, TAZ-type2.6SM00551
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2195
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
transcription cofactor activityGO:0003712IEA
nucleusGO:0005634IEA
regulation of transcription, DNA-templatedGO:0006355IEA
KO ID
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
K04498
*** None ***
Sequence
        6588 bases(100 bases per row)
ATGGACTCGGAGtCGTTTGTtGGTGACTTTGGcGTCGGACTGCCCATGGACAACCGGTATATGAACCAGCTCAACCTCGGTGGCATGGGCGGTGCCATGG
GCACAGGCACGAACGACCTCATGAACCCcGCGGGACTCGATTTCAGCAGCTCCATGATGATGATGGACACCAACTCGTCGCtGgTCGGTCCTCCAGGCTC
GTCCACAGGGATGATTGACTTCCCCGACGAGCTCAATTCGCCCAAGAACAGCACAACCACGGGCGCCAGTGGCGTCGCGTCGGCTGGAATCAGCACATCG
AGTACGTCGTCCGCCGACGCTACCATGACGTCATCCGAAGCCATCCCGTTCCCAGCAGCGCTCGCGAATGACCCCCCGTTGAATATGACTGGGAACGCAG
CTGTGGCAGCTCAAAACCGAGCCGCGATGAATGCCAGCGCGGCCATGGGCTTTCCAGGCATGGATATGACCTCGAGTGCCATGGCTGGTAACATGAATGG
CAACATGAACGTCAATATGAGCTTGGCCATGAACAACGGAGTGAGCATGTCGATGCCCATGAACATGGCCATGAACCCGGCGATGGCTCCGAACGGCTTC
ATGCCCGACATGAACATGGGACTTGCAATGAATAACATGTTCATGGGCGGTGCGTACCCGATGCAGACACAAATGAACGGCATGATGATGGGAATGAATC
CGCAAATGTACCTCACTCCTCAACAGCAACAGCAGCAGCAGGAGTATTTGCGAATGCTTCAGCAACGGCAATTCGCTATGCAGCAGCAACTCCAAGCCAA
CGCCCAGGCCCAGGCCGGCCAAACACAGAACAATGCGGCAGCAGCAGCGCAGCTCCGTCAGCAGCAGCTTCAGCAGCAAATGGCAGCAATGCAAAACCAA
GCGGCTCAAATGGCGAACGGTATCGCAGGTGGCGTGCAAGTATCTACAGCTCAGCAGGTGCGGCCGACATCACAAGTGGCGCAAGTGTCGACGGCGGCAA
CAACAGCAGCCACGAATGCGGCGGCGCAGAGGCAGTTCCAACAGAATGCTTCGACACATCAAGCTCAAGTTCACAAGCCGGCCGGTACAACTCCAGGTGG
AAGTACAACTCGTCAACCATGGCATTCTCCAGCAGATACACCGCTGCGCAAGGAGATGCTAAGTCATATTATGAGGGTTCTACAGAGTGAGAAGTCGAAG
GCACCAGCGAACTGGCTTCAGCGGTTACCAGAAATGGCAAGACGTCTGGAGGAGGAGTGCTACCGCATTTCGACATCTCGGGAAGAATATGCAAACACGA
GCACATTGCAAGTGCGCCTGAAGAATATCGTTCGCCAAGCTCAGACCCAACAGCGCGATCGTGTGGGTACCAGCACTCAAAGTGCCCCGGCTCGAAGTCA
GGGACCTACGTCCACGGCTACTCCTCAGGCAGTGTCTTCCGCGCCAGCTCTCAACCCAGCTCCTGTTCCATTTCCTGGATCAGATTCAGTGCCGCAGCAG
ACTGCTAATGTACATATGAAGCCGTTGCCTGCAGTGCCTCAGCCAATTCAAATGCCTTTGGAACTTCAAGAAACTCCTCAAGCAATTCCGATGCCACCTG
AGCTTCAGAATCCTGTTGCTCAAGCAAATGGAACTCGCACCTCGATGCCCAGTGACTCGACAAGTTCCCAACAATCGATGATGGATACAGCTGCAGCTAC
GAATGCAGCTGCAGCGATGGCTGCTGCGAACCAGAGTCGCTCGTCGCAGTTCCTTCGCCAGTTCAAGGCAAGAGCACAGCAAGTCACATCCGCCCTCGAA
GAAAAGCAGACGCGAGAATACCACAACAAGCTCCAGTCGATGACAACTAGTGACATGATGAACGCTAACTCGAAGGGTGTGCTTCAACGACAACAACAGC
GCCTTCTGCTCCTGCGGCATGCGATGTGGTGCAAAGCTGCAGATGGTGCATGTGTGGCAACACCAAATTGTGGTGAGATGAAACGTTTGTGGCAGCACAT
GGGAAACTGTCAAGAAACGACGTCGTGCTCTTACTCACATTGTATCTCGTCGAAGTACGTGTTGTCTCACTTTCAACAATGCGAGAACCAAAaGTGTCTG
GTCTGTCAGCTGCTTCGATTCCCCGTCGAGGTGAAGGAGAAGAACGGATCGTTGATGATGGATGCCGATCGCGCACTCCAGCAGATCCAAGCAGCCAGTG
AACGTCGCCAGGCAATGCTTCAGGGTCAGCCAGCCTCAGGATCTCAGCCCCAGCCTGCAGTTACCCAACCAGTCGCACCAAGCGTTAATAACCAACAAAC
CACGATGGCTGGGGCTGCAGGCCCCATGGGCTTTCAGGCTCAAGCAGCCATGAACGGACAGACATTGATGCCTCAGCAGCCAGATACCGCATCTCAAAGC
CGAGGGCCTACAAGTACTCCAACCCAGCCACAACGTACCCCACAGCCTCCCTCAGCACCTGCTGCAACTGTACCTGGACTGACTGAAGAAGAGAACCGTC
AGCTTGCTCTCATTCAGCAACGATTACGTGGTGTTAGTCTCGAGCAGCTCAATCTCAACTCGAAGAAGCTGGAAAACTATGCCGAACAGGTCCGGAGTCA
AGTGAATGCGATCATGAATGAGTGCCGGCAGATTATGCAAATGCGTAATACGACGCAAGACCCTGTGTTGCAGAGTCGATACGATGCAGAAGTGCAGGCA
AAGAAGTTGACGCTTCAAGATCTTCATCAGAAATACAAGAAGTGCACAAGCCAGCATCGTATTGTGAAGCACGTCATCAGCGCGCGAATAAGTGGGGCGC
CAATGGGTGGTCTGTCGCAGCAAGCACCTTATCAGATGACAGCGCCGCCAGCTCAGCCGGCTCAACCAGTTCAATCAGCTCAACTTCCGCCCACCCAGCC
TGTGAATAACCAAGGCCAGTTTCCTGTTAGTATGCAACCCATTGCCATGCCTCCAGGTCTTCAAGGTGCTCCGCAAGCTCCACCGCAGGGTCCTCAGCCA
GTCCCAATGCCTGTGCATCTGCAACCATCACTCCCTCAGCAGTCATTTTCGGCTCAGCTCCAAATGGCGCAAAGCTCGATGGTTCAAACACAAACAGCAA
GCTCGATGCCGAACGTACCAAGCCAAACGACAAACGACATCATCGGCCAGAGCTTGGGAATCTCATTGGGTGACAGTGGCCTCGGAATGGCTGGAAAGCC
TTTGGAAATGCCAAGTGACCTTCAGTCTCTCCCGCCTACTCCTGTGACGACGGCTCCACCAGCTGTGACTTCGGCTCCAGCTCCCTcGCCAACAGCCACT
GCCCCGAcTCCAGCAGTCAGTTCGATGCCGACCACGGCTCCGACCCCTGCTCCTGCTCCCGCTCCCGCTCCTGTCCCTGCTCCAGCCAACTCGCCTATCA
AAAGTGAACCAACTGTCAACCCACTCACAATGAACAACTCCAAGTTGAATGCGATGATGATAGAGCACAAGAGAATGGACGCTGCGAAGATAAAaGCAGA
GCcTGTTGCAGTGACCGTCAGCACAAGCACAAGCGCATTACCTGCAGCACCATTACCGTCTCCACCATCTACGACTGCCACTCCAGCTGTCGGTGACACT
CCAACGTCTATGTTGAATGAGCTCACAAATGAGCAGCTGAAGCAGCACATTGACTCTCTTGTGATTGGTTATAACGCAACCATGCAACCGGCTACGTTGA
AAagACGACTTGAAGGCTTGCTGAAAGGCATGATGGAGCACAAGTTCGGTTGGGTTTTCAGCAGTCCTGTCGATCCTGTTGCTCTCGACATCCCGAACTA
TTTCAAGATCATTCGTCGTCCGATGGATCTCGGcACGATCAAGAAGAAATTGGATGCTGGCGTGTACAAGCATATGGACCAATTTGCTGCGGATGTTCGA
CTGACATTCGAGAATGCCAAGACATACAATAGCGAGGATCAAGATGTTTATAATCTTGCGAAGGACATGCTGAACGATTTCAACGCGGAGATGCGCAAGC
TTGAAGCCGAGGTGTACGAAGAAGAGCGCGCAGCTCGAGCGAAAGAAAGCGCGTGTCGGTTGTGTGGTGTGGAGCGAATGGTATTCGAACCTGCGGTTCT
GTACTGCAACGGTGAATGCAACAGTCGTATTCGACGCAACTGCTATTACTTTTGCTCTCCTGACAACAAGTATCACTGCTGCCAGCCATGTTTtAACAAC
CTATCGGATGAAATTCGTGGTAATGAAGGGAAGACCTACCGGAAAaCGGaGTTGAGCAAAAAGAaGAACGATGAAGTGCACGAAGAGCCCTGGGTACAGT
GTGACAAGTGTAACCGATGGGTGCATCAAATTTGTGCACTATTCAACGGAAAGATTGATGCGGAAAAGAAGCCACAGGTCGTCAAGAACGAGCCAAATGG
CAAGACAAGTGGACCAGGATCTCAATCAAGTGCACATTCTATTTCCTCTACACCCGGGAGCGAATTTcTCTGCCCTGAGTGTcTCTTGGATCACCGTGTC
AaGGAGCCGGAGAAGTACATAGTTGGAAAGCACGCTTTCAATGCTAAGGATCTCATGCGAaCCAAGTTGTCCGACTTTTTGGAACGCCGCATTTACAAGG
CGCTCCAGGAAGAGCGAGAGGACGAGGCTCGCTGGACGAACCGCAATGTGAAAGATGTGGCCACTGCAGAACACCTGACAGTGCGTCTCGTGTCTAACAT
CGAGAAGCAACTCATGGTGCGCGACAAAATGTTCCAGCGGTATAAGGACTCACACAAGTACACATCTGAGCACCGGTTCAAGTCGAAGTGCATTTGTATG
TTCCAAGAGATTCACGGCGTCTCTGTGCTGTtGTTTGGTATGTATGTCCACGAGTTTGACGAACAAGAGGCTGAGTGCAATTCCCGTCGTGTATACATTT
CGTACTTGGACTCCGTCAACTATTTTGAACCGGCACATTTGCGAACCAAGGTGTATCATGAGTTGCTGATCGCGTATTTGGACTTCGTGCGCCAACGTGG
GTTCCACACTGCTCATCTCTGGGCGTGTCCGCCGCTGAAAGGTGATGATTACATTTTGTACTGCCACCCAGAGTCTCAGAAGACCCCGAAGTCGGATCGT
TTGCGACAATGGTACGTCGACATGCTGACAAGAGCGCAGCAGGAAGGCGTCGCATTGCACATTTCAAACCTCTACGACGAGTACTGGCGGAACAACAACA
CAGCATGCGTTCTACCGTACTTCGAAGGTGATTACTGGGTTGGGTTGGCCGAAGAAGTGATCGAGAAGTTAGATGCGGAAAAGCCGAAGAAGTCGAAGAA
CAAACGCAAATCTGAGACGAAGAAACCGAGTAAAAAGTCGAAGAAGTCAAAGACGAAGAGACGGAAGATGAGCACCGCAGGAAGTGGCACGAGTGGCGGC
GAGCATGAGGACAATGCGACTGGATCCGATGGTGAAGGCGATGGAAACGACGACGACGAAGGTGACGCGTCGATGGAAGAACCGACGACGACGTCCGAGA
AGAAGGAGCGGGCGATCACGTCTCTGGATGACGTGGATCGCACGATCACTGATCCGCTGATGAAGAAAATGGGCGAAGTCATCGAGCCGATGAAAGACGA
CTTTATCGTCGTCAAGCTGCAGCCATACTGCCGCCTCTGTAACACGCCTGTGCTCAAGGGCACACTTTGGCGAGACCCGACCACATCAACTGCGTTGGGA
CTGAACCCGAaGACCGTGCACGTGACCGTGTGCGATGGCTGCTACCAGAAGGCCAAGGCAACTCCCAACGCACGCGTACAGGAACAGCTCAAGAAGTTGC
AGCCGGAGGAAGTCACATGGCCTGAGAAGTGCACCGACCCTGACGAAGTGAACGACAGCGAGTACTTCGATACGCGCCAGGCATTCCTGAGCCTTTGCCA
GGGCAACCACTACCAGTTCGACGAGCTGCGGCGCGCCAAGCACTCGTCGATGATGGCGCTGTACCACTTGGGCAACCCGAATCCGAACGCGTACGTGTAC
GAGTGCAACGCGTGCACGCGCGACATCGTCAGCGGCAACCGCTGGCATTGCCACACGTGCCCCGACTTCGACGTGTGCGACGCGTGTTATGCCAAGGAGA
AGCACGAGCACCCGCTGGAGAAGATCCCAACGAGTGGCGTGGCTGGCGCTGGTGGCAAGGGCGGTCAGTTGCAGGGCTCGTTGTCGGAGGAGCAGCGTCG
CCAACGCGACCAACGTGCCAAGAACGTGCGGCTGCACATGCAGCTCCTGGTGCACTCGAGCAGCTGCGACGGCTCGTGTGGCTCAGGCAATTGCGAGAAG
ATGAAGGAGCTGATGCGCCACGGAGCCGTGTGCAAGCAGCGCGCGCTCGGTGGCTGCACAGTGTGTCGCCGTGTGTGGGCATTACTGCAGCTCCATGCCC
GTCAGTGCCGTCAGTACGAGTGTAAGGTGCCAcGCTGCCACGATCTCCGCGAGCACGTGCGCAAGCTGCAGCTCCAGCAGCAGCTCATGGACGACCGCCG
TCGTGCGGCCgTGACGCAGCAGTACCGACAAATGCAGAGCGGCGGACAGCCCAATGGCGGCGACGACGACCCCACGGGCGGCGCATGA