Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.12
Orientation:
(+)
Number of Exons:
2
Description :
GPI anchor protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5940.73325
InsideOutsideTMhelix
1-427
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1367 bases(100 bases per row)
ATGAAGATCATCAGCGTCCTCCGCACCGCGCTCCTCGTCGCGGCCGTCGTCGGCCTCAGCGCCGCCGATGCCAAGAAGCCGAAGCTCTGTGACGCCGACC
ACCcGGCCCCGGCTCCTGCTCcGGCCCCAAGCGCTGGTGGAAACCCTGGCCCAGCTCCGGGTGTCCCAGCTCCAGGCGCGACCCCAGGTGCTCCTGCTCC
AGGCCCAGGCCCAGCTCCTGCTGCCCCAGCGTACGGTCCTGGCCCAGCGCCTGTCGCCCCTGCCGTGGGCACCACGCCGGCGCCAGCCAAGGCCGAGTcG
GCCACGATCTCGATCTCCATgccaagcaagaacgcaacggccggcaacgacgaagaagacgaggacgacagcaaggacgacgatgacagcaaggacgaca
aggccaagggcgacaacaagccggcctCGTCGGCTCCTGTGTcgtcggcgccaNNNNNNNNNNNNNNNNNNNNNNNNaccgtacaagggcaaggatgccg
ggtggccctggcacgtaccagATGGTcACGGAcGTCGCGAcGTGcTCCAAGACgCCGCACGCcATGTAcAGCCCGATCTCGCcACTTGACGATGATCTTA
CGTTCGTCTTCCGTGGCCCAATGACCATCCACAACATCGCTATCTTCGACGGCTCGAGCGGCTCGTGGAACAAGGTGTCGTCGTTCGACAAGGCCGCTGG
CAAGgCGGACAACCTCGtGTTCCTCAaCAACCGCAACATTGACTACGGTGGCAAGTCGGCTCCTCAGGGTTACgCCGCTGCTGATGGCCGTGGCAAGGCC
GAGAGCGCGCAGCTCTTCTCGGGTGTGCTAGGTGGTGCCACCAACGCCAACGGTGCCTACGGTGATGAGAAGACGGGTGCTGAAGTCAACATCTTCCAGG
ACAAGAAGTGTGGTGCTGACGCCGAGTGCAAGGGCTACTACGACAAGGACGGCACGGCTCTTCTTGGCTGGACCGGTGCCAAGAAGATTTTCGTGACCAA
GGTGCAGATGCCGCGTGGCCCTGCGCCAGACCTTCCAGCCGTCTGGGCCCTTAACGGCCAGATCGTGCGCTCGAACCAGTACCAGTGCAACTGCCGTGGT
ATGGGCAAGGAaGGAGGCTGTGGTGAGCTCGACATTGTCGAGGTGCTCGaGAAGGaCACGAGCGTTCTCGCCACGCACTACTACAAGTaCGCTGACAGCA
CGGGCCACGACTCGTGGgCCAAGCGTCCGATCGACGAGCCTGCCGTCTACATCACGGTCATCGACGAGTCGTTCGGTGTCAAGGTCATCGAGGTTGGCTG
CGACGAGTTCGACTTCGGTGCCGGCTCCATCTCAAAGGACGTCGTCGCCAAGTGGCTGAGCGCCTAA