Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.2
Orientation:
(+)
Number of Exons:
1
Description :
Cysteine protease family C01A
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase C1A, papain C-terminal3.4PR00705
Peptidase C1A, papain C-terminal3.4PR00705
*** None ***
HmmSmart predictionP-Valprediction_id
Peptidase C1A, papain C-terminal1.8SM00645
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-311
*** None ***
PositionContextScore
292GYIRMKR|GG0.653
*** None ***
GO
Biological ProcessGO IDPrediction Method
cysteine-type peptidase activityGO:0008234IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        936 bases(100 bases per row)
ATGTTCCCATCGGGCAGCTACAGCTTCCAGGATCTGATCGACTGGTTCAACAAGAACTACCGCCCAGGAAACCaGCCAGTTCAGCCAATTCAGCCTGTTC
AGCCAAACCAACCGACTAATGCCCCGGCCAACGTCCCAACCCAGCGCCCGTCGTCGCAGCGTCCATCGCGCCCGACGTATGCCCCTACCTCTCGTCCAGT
TGGCCCCGTAGCTCCAGTCGGCCCAGTCGCCCCGGAGAACCCAGTGACAGTCACTCCAGCCCCAGCTCAGGAAGAAGCTGGTGAAATTGGCAACGACGGC
AACAGCGTTGACTGGTCAACGAGCAAGTGCATGCCGCCAGTCCAGAACCAGGGCCAGTGCGGCTCGTGCTGGtCgTTcGCCACTGTGGCTGCTGTTGAGA
CAGGAAAGTGTCTGGCAACTAAGGCCTCGTCGTTCGTCAAGCTCTCGGAGCAGAACCTTGCCACCTGTGACaCCCGTAACATGGGCTGCAACGGTGGTGC
CACGAGCTAcGCCATGAACTACcTCCAGAAGAACGGCGTGTGCAGTGCTGCTGATGTGCCATACACGATGGGTCAGTCtGGCCGTACAGGCAGCTGCAAC
AGTGGTTGCACCAAGATCCCATCCGGCATTAAGAGCACTCCACGTGtCCAGGGCGAGAGCGGTCTCGTGAGCACACTCAACACGCACCCAGTCGTCATCG
CTGTCGCTGCTGGCAACAACGCCTGGAAGCAGTACGCCGGTGGTGTGCTCTCGAGTTGCCAGACTTCGCAGGTGGACCACGCCGTACTTGCTGTGGGATA
CGACGCAACCGCCATCAAGATCCGTAACTCGTGGGGCGCCAACTGGGGTGAGAAGGgCTACATCCGCATGAAGCGTGGTGGCAGTGGTACGGGCACGTGC
AGCATGTACACCGATATGATCCACGCCACATTCTAA