Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.0
Orientation:
(+)
Number of Exons:
1
Description :
Serine protease family S10
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase S10, serine carboxypeptidase1.6PR00724
Peptidase S10, serine carboxypeptidase1.6PR00724
Peptidase S10, serine carboxypeptidase1.6PR00724
Peptidase S10, serine carboxypeptidase1.6PR00724
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-34
53-505
35-52
NN-scoreoddsWeighted Score
0.6812.0970.004
*** None ***
TypeScore
mitochondrial478
GO
Biological ProcessGO IDPrediction Method
serine-type carboxypeptidase activityGO:0004185IEA
proteolysisGO:0006508IEA
KO ID
K13289
K13289
*** None ***
Sequence
        1518 bases(100 bases per row)
ATGACGCGCACGTCGGAGAACACGCCGCTTGTGGCGGTCGCGGGCGATGGCCGCAGCGCGCATGCAGCCACTCGGCGCAGTAGCAACCGCCAGACGCATC
GTCTCCTGTTGGCTGTGTCGGGACTCGCACTGCTGCTCACACTGTTGGCAGTGACGCGCGAGAGCTCCCCGGGCTCACAGATCGTCACGACCAAGGACGC
GGTGAGCAACAACGCTAAGAAGGTAGAGACTCAGACCGAGGCAAAGGGGGACAAGGACGAGTTCTTTTGCGGCATCACCAAGCACGAGACGGGCTACATC
AAGCTCCCGAACAAGAAAGACGACCACTACTTTTACTGGTTTGTCGAGTCTCGTAGTGAACCGAGCAAGGACCCGCTTGTGCTGTGGCTTACGGGAGGAC
CTGGCTGCTCAAGTATGATGGCATTGCTCGCGGAGAATGGCCCGTGCCACGTCCAGACGAACCTGACGACCACGCTCAACGAATACTCGTGgAACCGCCA
GGCGAATGTGATCTGGCTTGACCAGCCAACGGGCGTGGGCTACTCGTATGGAAGCGACGACGACTACGACAGCACGGAGGAGAACGTGGGCGAGAACATC
TACTGGTTCCTTCAGGAATTCCTGAAGAAGCACCCAGACCTCGCGGATCGCGAGTTCTTCGTCACAGGCGAGAGCTACGGCGGCCACTACGTCCCAGCGG
CTGCAAGCTACATCGTCCAGCAGAACGCCCTTCGTCGCAAGCATCATGGTGCCGTGCACATCAACCTTGCCGGTATCGCTATTGGTAACGGTATCACGGA
CCCGATCGTGCAGTACGACTTCAGCGTCGACATGGCGTTCAACACGTACAACATCTCCTTGCTCTCCGAGGCTCAGATCGAGGACATGCGTACAGCGCAG
CCCATCTGCCATGAACTCAACGTCAAGTGTCAGACGGATGACGATGCGTGTATTCAGGCGCTGGAGTACTGTGGTGAGCACCTGGAGGCTCCGTACATGA
CGGCTGGTCGCAACCCGTACGATATTCGTCAGGAATGTCACGAAGAGAACGTGATGGACTGCTTCCATTTCGACCACATCATCAAATACCTCAACTCACC
GAAAGTTCTAAAGGCTCTGGGCGTTGACTCCAAGCACACGAAGGCGTGGCGTGAGTGTGACGGTGACGTCGGCCAGCGCTTCCTCCTCGACGAAATGCTT
TCGTTCGCTCCGAACGTCAAGCTATTGCTTGAGAGCGGTGTGCGCGTGCTTATCTACGCGGGCGACGCCGATCTCATGTGTAATTGGGTGGGTAACGATG
CGTGGGTCAAGGCTCTTGAATGGAGCGGCAAGGCCAAGTACAACGCCGCTGAGAACCGCGTGTTCGTGACCAAGGCGAACGCCAACGCTGGTTTCATTCG
TTCTTTCGAGAACCTCGCGTTCATCCGCATCTTCGACGCCGGCCACATGGTGCCAATGGACCAGCCTGAGGTGTCGTTCGAGATGATCAACAACTTCTTC
CAGGGCAAGCCTTTCTAG