Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.3
Orientation:
(+)
Number of Exons:
4
Description :
Acyl-[acyl-carrier-protein]-UDP-N-acetylglucosamine O-acyltransferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-363
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00677
*** None ***
Sequence
        1308 bases(100 bases per row)
ATGGTGATGGCGACGCTGCTCGTTCCGCCGGTGCTGCGGTGCTGCCGCCCGCTCGAGGCAGCCGCCGTTGACTCGCTGCTGCTGCGTAGCTCAAGTGCCA
GGCGTCTGGTGCGTGCGCTCTGTGGATTTCGCGCTGAGTGCCGCTGTCGAAGCTCATGAGATCGATGTGCATGGTCGCCAGACATCAGCTTCGTCCGCTG
TGATGCAGTCCATGGAGGACCTTATCGACCATGCCGCTGTGCGTACGATGAACACTACTGCTGACTGATCGTGACGCACTGATCGCGTCGTGTGCTGGAG
CCAGACAGGGAAGCGCGAAGAGCAGGAGGCGAGGCAAACGGGCGAGTCGCCTCTTGCGTTTCATAACGACGCGCTGTTGGACGACCGTGGCTTCGTGCAT
CCGACTGCCGTGGTGCATACGGGGGCCTCACTTGGTCGCAATGTGCGCGTTGGACCGTACAGTGTCATCGGACCCGACGTTGTGCTCGAAGACGGCGTCG
TACTGCAGTCCCATGTCGTGGTCGATGGGAAGACCCGGGTCGGCAGTGACACAATCGTGCATCCGTTCGCATGTATCGGCGGTGAGCCACAAGACAAGAA
GCACAACCGACTTCACGTGCCGCACGGCGACACGTTCCAGCTCGAGATCGGGCGCAACTGCGTGATCCGGGAGCACGTGACGATCCACGGTAGCACATCG
TACTCAGGACAAACGCCGACTTCGCTCGGTGACAACTGCTGGATCCTCTGCGGTGCTCACGTCGGTCATGACGTGCAGATTGGCCGcAACGTTGTGCTGT
CCAACAACGTGATGGTCGCTGGGCACGTCGAGATCGGCAACTTCGCGATCATTGGAGGACAGGTCGGTCTCAAGCAGAACATCAAAATCGGCAGCCTTGC
TATGATCGGCGGAGGCAGCGCCGTTGACGGCGACGTGCTGCCCTACGGACTAGCGAGTGGCAACCGCGCCAAGCTGCTTGGCCTGAACCTTATTGGGTTG
CGTAGGGCTAAGATATCACGGCACCAGATCAAGCTTATGCTACGTGTCGTGCGCTACCTCTTCGGCTCTTCGCTGACGAATATCGCGGCAGTATGTCCCA
AGACTGGCTTCGCTCCAGCTCTCGAGTAAGATCTTGTTTGCATAGAAGATTGGTTCTCTCGGATGGATGAACTGACTGGACTTGTTGTCGTGTGGtGTTT
TACAGTCTGCCTCACCATGATTCGGTTCTGCTTCGTGCATTTGAGGCCAAGCGATACCTCGCAGACATCGAGATCAGTACGgAAaGCAACCCGTTTGTCC
ACGAGATT