Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.18
Orientation:
(-)
Number of Exons:
2
Description :
Pseudouridine synthase, RluA family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Rhodanese-like domain17.175PS50206
HmmSmart predictionP-Valprediction_id
Rhodanese-like domain2.8SM00450
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Rhodanese-like domainIPR001763
*** None ***
InsideOutsideTMhelix
1-317
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1019 bases(100 bases per row)
ATGACCGGCGCACAGAATGCGGATGCAGGAGCCGTTGGGGGCGGAAGCTCCAATGTTGTGGAAGGAGGCAGCGGTAGTGCGGCGCAGATCGTCAACTCAT
CCGCGTACGGGTTCTGCGTCTTCTCGGCCGAGGAGCTGCCGCGTCTCAAGGCGCTGCTCCTAGAATGTGCTGACCGTTTGGGGGACGCGCACGAGGAGAT
TCGCGGCACGATCTTGCTGTCTGAAGAAGGCGTGAATATCCGACTGAGTGGTACTCGGCGCGCGACGGATGCTATGAAGGAGGCGCTTCGAGGACTTCAC
GTGGATCTCGCCCACATGGAGTTCAAGGACTCGTATTCCGAGCGGCTGACGCTGCCGCGACTGCTCGTCAAGTTCAAGAAAGAGGTCATCTCCATGGGTG
ATCCGGATGTGAAGCCAGCGGTTGACGGGCTTGCTGCTCATATCTCGCCCGAGGAGTTCAAGCAGTGGCTGGATGAAGATCGCGACATGGTCGTGCTGGA
TACAAGGTAAGGTTATATCGGGTGGAATTGGTCGTGAGTCGTTTCCTTCTCTGACGTGCACTCGCGAGTAGGaATGACTATGAAGTACGTTTGGGAACAT
TTGAAAAGGCTGTGGATCTCGACATTAAGAGCTTCCGCGCCTACCCGACAGCAGTCAAGGATCGACTCAAGGACGTACCTAAGGAGAAGCCCGTCGTGAT
GtTTTGTACTGGTGGCGTGCGCTGTGAAAAGGCAGCGTACACCTTGATTAAGGAGGGTCACAGGCGCGTGTACCAGCTGGATGGTGGCATTCTGAAGTAC
TTTGAACGAGTTGGTGGTGCCCATTACCGTGGAGACTGCTACATTTTCGATGATCGTGTCGCGCTGACCCCAGAGTTGAAGGAAGGCGATGAAGTCGCCT
GCTACGTCTGCCGGAGTCCGCTTACTCGTGAGGAGCAACAGTCATCTGACTACGTGCCCGGCAAACAATGCATGTTCTGCAAAGATGGCAAGCCGGATGT
GCATGCAAGCCAGCAATAA