Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.64
Orientation:
(-)
Number of Exons:
1
Description :
60S ribosomal protein L35
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-130
NN-scoreoddsWeighted Score
0.8454.7050.009
*** None ***
TypeScore
nuclear870
GO
*** None ***
KO ID
K02918
*** None ***
Sequence
        393 bases(100 bases per row)
ATGCGTCTGTGGTTGATAGTGGCTCAGAAGGTCAAGGCTCACGAACTCCGCTCGAAGACCAAGGACGAGCTCCTTACCCAGCTGGATGACCTCCAGCAGG
AGCTTGCCCAGCTCCGCGTGGCCAAGGTCATCGGCGGTGCCGCTTCGAAGCTGGCCAAGATCAAGGTCGCTCGCAAGTCGATCGcCCGTGTGTTGACGGT
GTACAACCAGACCCAGAAGGCGAAGCTCCGTGAGGCGCTTGGCAGCAACAAGTACGTCCCACTGGACCTGCGCCGCAAGAAGACGCGCGCTCTCCGTCGC
GCTCTCACCAAGCACGAGAAGGGCCTGAAGACGCTCAAGCAGCAGAAGAAGGAAGCGTACTTCCCAAAGCGCCGCTTTGCCCTTAAGGCGTAA