Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.58
Orientation:
(-)
Number of Exons:
1
Description :
Prolyl 4-hydroxylase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Oxoglutarate/iron-dependent dioxygenase8.643PS51471
HmmSmart predictionP-Valprediction_id
Prolyl 4-hydroxylase, alpha subunit3.5SM00702
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-377
*** None ***
PositionContextScore
6-MMRMGR|SV0.659
*** None ***
GO
Biological ProcessGO IDPrediction Method
oxidoreductase activityGO:0016491IEA
oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donorsGO:0016706IEA
iron ion bindingGO:0005506IEA
oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygenGO:0016705IEA
*** None ***
*** None ***
Sequence
        1134 bases(100 bases per row)
ATGATGCGAATGGGGCGAAGTGTGATGTCATGGCGGCGTTGCCTCAGCTCTCTGGCGGCACGCCACCCAGCATTACCACGCGCGCCACGCGGTGAGCTGC
TTCATGACGTCGCGGCACATTGGCAGTCTCTTGTAGCGTCCACAGACGCAGGCGCGTCGCTGCTGCGTGATGGATATTGTGTGCTCCGAAATGCGTTCCC
AGCGCCCTTCACCGCGCTGCTGCGCGACGAGATGCGCTACCTCCATGCGACCGATCAGATGTACGCGAACGCCACGCACATCATGCTGCATGGCGAGCAG
CAGCCGACGCTATTGGAGAAGCACCACATCGTCGAGACGGAGCTTGtGTTTCCAGAAgTACGGGCGCAAGTgCCGGCACTCCAgTGGTTCTTCGACTCGC
AGCAAGTCTACAGTGCACTGGAgAGGGCGACGCCGGCGTGGCTCGGGCTCAGCAGCTACATGATCAAGTTACAGTACAACGAGGGCCATGGAGGGTGCTT
CCCGATGCATTTCGACTCGTACGGCGACGATGGCAAGTGCATCACAGCAGTTCTCTACCTGAACGACAACTGGCAGGAAGGCGATGGCGGCGAGATCGTG
CTCTACCCATTTCCACGCAGCCAAAAGCCGGTGGTGATGAGTCCACGGGATGGCGATCTTGTACTCTTCTCGTCCCAGCAGATGCTACATCGCGTGCTAC
CGGCCTCGAAGCCGCGCTTCTGCCTCACAACATGGATCTATGCCAACCCCAACCAGCGAGTCGCAGCGCAACAACGTGCTGCGTTCTATAAGTCGGACGT
GGACCTCAAGACGTACAGACTTGCGGTCATGGATAAAGTCATGCGCTCCAGCATCCGGCGGCACCTGGCAAAGCTCGCCTACAGCCAGGAGTGGGAGACC
TCGCTACTGCAATCACACCGGCACACACCAGAGTTCGCCAAGTACATGGCGACACACGAACGAGAAGTCGGCGTTATCGAGGCCGCAACGGCACAGATGC
TGGCCAAATTCCGAGCCAAGGATCCAACGCAACCATCAACGATCCCGGAAGTCGCTTCGCAACTGATCGAGACCATGCAGGACGACGATGAGATGCGACG
GATGCTaGAAAAGATGTCTGTTCCgtGGTTTTAG