Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.56
Orientation:
(-)
Number of Exons:
4
Description :
Myotubularin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Myotubularin phosphatase domain81.267PS51339
Protein-tyrosine/Dual specificity phosphatase8.568PS50056
HmmSmart predictionP-Valprediction_id
Protein-tyrosine phosphatase, catalytic3.1SM00404
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Protein-tyrosine phosphatase, catalyticIPR003595
*** None ***
InsideOutsideTMhelix
1-1136
*** None ***
PositionContextScore
1040LLERHRR|GA0.621
*** None ***
GO
Biological ProcessGO IDPrediction Method
phosphatase activityGO:0016791IEA
*** None ***
*** None ***
Sequence
        3714 bases(100 bases per row)
ATGGCGTccCATGACGCCAGGAAGAAACCCGGTGAAGATGACGCGtACTTCGCCCAACGACAGTCGACTATGGACAGCGCgaCGCtCGaCaAGCTGCTCA
TGGCCCAGAAGAACCTCTTCCATGCCGACCAGGCCACGCTGCAGGCCTGGAAGCTCATCGGTCGcgaCCCCGACTCGGAGAACGCCGCCGCTGCGcACCC
GAATGCCGCGGCGGCCGCGATTCTCAATGCAGCCGTGCAGAGCGCCGCTGCCCAGGCCGCGACCTCGTCCTCCGCCAGTGCAAGCGCCCGCGCGCgGTAC
GCCGACCGAGAGAGCGACCTGTCGACGAGCCACCTCAGCGGCGCCGTTCCCATCTCACGAAGCAACCCCAcGGTCCATCATGGCGCCGCGAACGGCAACG
GCTCTTTTGAGAGCAGCCCCAGCAGCTCGAACGCGAGTTTGCTGTCGTCGTCGCCGCGGCTAGCGATGGAAATCCCCCGTcCGGAACTCACGGCCGCCGC
GCTGGGCGGGAGCGGTCGTAGTTCGtTCGGCCAGTTGTCATCCTCGTCGGCCATCGCGTACGACCGCCAGGCAGGCACTTCCGCGGTCTACAGCGCCCGC
TCGACCATGGTGTCGACCACGATGGAGGCTATGAACGAAGGCAACTTCCTGGCGGAGAATGGCCGCAGCAAGTCGTCCCATGCCAACCTCTTTGGCTTCA
ACAACCGCGGCGATGCGCCACCACCACGCTCGGACATCACGCTGTTCCACTTCACCGTGCGCAAGTACGACAGCATGTTCGAGAAACTTGGCAGCAAGAA
GGCGACGATCCAGTTGCAGGTCGACATCGAGGCCCGCATGCTCAACTTCATCTCACCTCACGAAAACCGCGAGAGCTACTCGTGTGCGGCTGTAACAGCT
CGTCCACAGTCGCGGCTTGGCATGCAGCTCAAGATCCAGACTGGTACGACGTCTATCACCAAGAAGATCAACTTTCTCAGCACCGAGGAACGCACCAACT
TCTTGGACGCTCTGGAGCAGGGCAAAGTCATGTCCAAGAAGACGCCGCAGCCCTTCCGCACGGTCTCGGAGGTCACGCAAATGTCGGACGACGCGACTGT
CGCGTCGCTCGACTCGACGCGCTCGAAGATCCGCGAGTCCATTCTCGTGGACAATTTCACGCCGCTTCCAGGTGAAAACGTGCTCGAACATGTCCAGCGT
GTGACCAACCTGGTGGTGATGTCCCAGAGTGACCGTGCGGTACAGGGCGTTCTCAAGATCACCACGTACCGTATCACTTTCTCGCCGTACGACTCCTCGT
GGCGCTTTGGATCCTTTGAGGTTCCTCTCGCGACCATCGATGTCATCACGAGAGACGGACTCATGCTGTTGATCTCGTGCAAGGACCTGCGCACGATCCG
ATTGGCCATGCATGACGCTTATACCAAGAAGAAGGGCTACGACCAGCTGCCGTCTACACCTGACTTCCGATGGCTCAACTCGCTCACACAGCGCATGCGT
CCACCCAACATTATCGGTGCTCTGTTCGCGTTCGAGTATCACGCAGAGAAGAAGGCCCGCATGGCCAACAAGCCAAGCGCGAAAGAAGATGGGTGGCGTC
TTTATTCGCCTATCACGGAATACCAGCGCCTCGGCTTTCTGCGTGGTGTCGACTCGTACAACCGCAAGCATGGGGTTGATCCGAACGTCATCACGTGGCG
TCTGCTAAAAAACTCCAAGTTCCGCTTCAGTCCAACGTACCCTCAGCTCATGGTTGTGCCGTCGTTAATGACCGAGGAGCAGCTCGTGCAGTCGGCACGT
TTCCGtTCGCGTGCTCGTCTTCCTGTTGTTGTGTGGCGTCATCCAGTCAACAAGTGCGTACTCGCTCGTTCATCACAACCCAATTATGGTATGGCTGGCA
ACCGATCCGAACCGGACCGGATACTTCTGAAGGCATACCGCGATTCAGCAAAGaAGAACAGTAACGGTGACTCCCCACCGCTTCATATCATCGATGCGCG
TAAGCCTATCGCCACGAAGGGTAATCGCCTCAAGGGCAAGGGTGTTGAAAACTCACAGCACTATGACAACGCCAACGTCGAGTTCATGAACATCGCTAAT
ATCCACAAGATGCGTGAGTCCCTCGATGCGCTGAAAGGTACGTTTCACTACCACGCTGATTGCGATCGTAcCATCTAACCTTCGTTGATTCGTGTCTAGC
CCTTGTTAGcCCCAATGCTGTTGATGATGGCGACAAGCACTACCACAAcCGTCTCGAGAGTACGTAGTTCATCATTCGTCTTGAGGAATGTTCTCCATCT
GATTCAAGTCTTCTCTGCAGACaCTCGTTGGCTAAAGCACGTGATGCGAgtgctgtctggtgctcgtcgtgttgcagaagttcttcaTGAAGACGGTGCA
TCCGTGCTGGTTCACTGCAGTGACGGCTGGGACCGcACTCCCCAGCTCGTGGGCTTGGCACAGCTGATTCttgatccgtactaccgtaccatccgtggct
ttgcNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNgttttgattgagaaggagtggtgttcattttggccacaaatttgCCGaCCGTATAGGTGTGGGCAAGGATCCGACAGACCAGCCGAACGAG
CGTTCGCCGGTGATGCTGCAGtTCTTGGACTGTGTGTGGCAGATGACCCGGCAGTTcCCCACAGCCTTCGAGTTCaACGaAAAGCTGCTGCTTCACGTGT
CGGACGCGCTTATTTCCGGTCTCTACGGCACGTTCCTGTACAACTCGGAGCGTGAGCGAATCTTCGAGAAGGTCTGGGAGCGCACTGAGTCAGTTTGGAC
ACCAGtGCTTGAGAACCCTGGCCCATACAAGAACCCAATGTTCAGGGCGACAAACCGTGTGCTATATCCACGCGCGAATCTCAAGCGAGTTGTTCTCTGG
GATGCCATGTTCTTCCGCTGGGATCCTGAGAGCCATCCAGATTACATGGAGTTTATGGACGCAGTGGATCCAGAAGAGGGTGTTCAGGTCGATGATCATG
GATACGATGATGATGATGGTATCGGGCTGGTCGGCGGACTTAGCACCGGCGGCGCACAGCGACCAGACTTTGACGAAGTTGACAAGGCTCTCCGACTCGA
AATCGACGTGATTCATGATTTTGACGAGTTACGCATCAGGTCGGGAATGTCTGATTGCTCCGACATGAGTGACGACGACGAGCTGGAACTGCGCATGTCG
CTCTCGGCAGACCAGTCACCGATGACGGCCGATGACCTTAACGGCCACGATTACCAGGATGGCCCCGGTCGCCTGGAGACTGTGTACGATTTTGACGACG
AGCTTCTCGAGCGACATCGACGTGGCGCAGAGGAACGCACGCGTCAACGCGCACAGGGCCGTAACATCCGCGAAACGATCCAGATGGCTCCTGACCAGAG
CCGAATCAAGTACCTGGAACAGCTCCTCAGTGAGAGCGTGGCGCGTGAGTTGCAACTTGAGGCCGAACTCGACTCCATGCACCATCGCGTTGCAATGCAG
CGAGCCACTGCCGCGTCAACTTCTGGGTCTGGCGGCAACGGAAGTGGCAACAACAACAACAATGGCACTGGCCGCCGGAACACTGGCTCGGGCCAGCAAT
CGATTATGCTGTGA