Transcript Name :
Pytap_DAOMBR444snap_masked-pag1_scaffold_1-abinit-gene-0.78
Orientation:
(-)
Number of Exons:
1
Description :
FtsJ methyltransferase domain containing 2
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-153
NN-scoreoddsWeighted Score
0.6171.5020.003
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
*** None ***
Sequence
        462 bases(100 bases per row)
ATGGCGAATCTCGAtTTCTTATTCCAGTGGACTGAGAATCACAAGGGTTTGGAGCAGACAGAGGAGCCGTTCGTGTTTGCCGACATTTGCGGGGGTCCTG
GAGGGTTCTCTGAATATTTCCTGTGGCGGATGCAGCAATCGCCGCCTCAAAACACTGGTGCTCCTGAAGAAAAGCAAAGTGCGATACAGTTGGATGCCGT
CGGGTTCGGCATTTCTCTGCGAGGGACGGATTCGTGTGACTGGAAAGTGGATGTTCGAGAGACTGAATCGGGACCAACAGGGCGTGTAGCGTTTCATGTG
TGCGACgGGGCCGACGGCACAGGAGATTTGTATAAGCTCGTCAACATCCACGCATTTaAAAACGCTGTCCAGCAAAAGTTCCCAACAGGTGCCCATCTCG
TGGTCGCAGACGGTGGTTTCCCTGACGCCCGTGACCGCCATAACCAGGTTTGGCTTCCTTGA