Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.16
Orientation:
(-)
Number of Exons:
1
Description :
HSF-type DNA-binding
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Heat shock factor (HSF)-type, DNA-binding2.6PR00056
Heat shock factor (HSF)-type, DNA-binding2.6PR00056
Heat shock factor (HSF)-type, DNA-binding2.6PR00056
*** None ***
HmmSmart predictionP-Valprediction_id
Heat shock factor (HSF)-type, DNA-binding6.2SM00415
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-666
*** None ***
PositionContextScore
134SITKRKR|GV0.566
*** None ***
GO
Biological ProcessGO IDPrediction Method
transcription factor activity, sequence-specific DNA bindingGO:0003700IEA
nucleusGO:0005634IEA
regulation of transcription, DNA-templatedGO:0006355IEA
*** None ***
*** None ***
Sequence
        2001 bases(100 bases per row)
ATGCCGTCCACCTCGCCGTCCAAGAAGCGTCGCGGGATGGAAGCGACGTACGGTGGCAATTCAACCGAGAAATCCACTGCCGAGACACCGGCGCCGTCCC
ATGCCGCCGTAGTAGCCGACAAGCAGGCTGCCGTCCAAGCCCCGAGCTCGCCCAGCTCCGTCGATTATGCAAGCGACAAGTCTGCGTCTTCCACTGCGTC
ACCCTCCGACTCGTCCCGAATGACCCCGCGGTCTCTGGACGCATCGTCCAAAGACCGGCTCCGCATCCAGGCGCCAACATCCACTACGTCCGGCCAATCG
TCCAGATCCCCAGCGTCCGCTTTCTCTGCACCCACGTCCCCAGCGGACGATGGTCTGGAGACGCCTGATGGCAGCGAGTCGAGCATCACCAAGCGGAAGC
GTGGGGTCGACGATGCAGGCGCCaCCACGGCGCCATCACCGCCGCTCTTCCTCGAGAAGACGTACGAGATGCTGGACAAGAGCGCACCCGACGTGGCGTG
CTGGTCGGCTGGGGGCGACAGCTTCATCGTCAAGAACCCATCGGCGTTCGCAGAGCACGTGATCCCCATCTACTTCAAGCACAAGAACTTCAGCTCGTTC
GTGCGGCAACTCAACTTCTACGGCtTCCGCAAGGTGCGCGTGGTAGACCCCGAAGTCACGGGCGGCGTGGAcCCGAAGGACTGGTGGGAGTTCCGCCATG
ACAAGTTCGTACGTGGTCGCAAGGAGCTGCTCAAGGACATCAAGCGTCGCACGCATTTTGGCGGGAATGCAGGTGCTGAGACGGCAGCGCGAGCGTCGAT
TGACCGCGCTGAGATCGATGAGCTGCGCACCGAAGTGTCGTCGCTGCGTGAACAGATCCAGACGCTCAACAAGCACATGTACAGCGTCATGCAGATCATG
ATGATGCGCAACGCAGCTGGAGTCACGCCAGGCCCGAATCCAGGAGCGTATGCCACGCACGCGCTGGTGTCGCCGCACCACTTGGCACCGCCTCCTCCTC
CGCACCACCAGGTTGTCTACGCCGTGCAGCACGGCCGCCCGCCATCTCATCCAGCTCCACTGCCTACGCCTTCTACCAAGAGCGAGCCGCGCGGCTTAGC
ATCGGCAACGACATCCAACGGGATGCCAGTGTCGACGCCCACGGGGACgTTTGCCCTGCGGCCTCTGCAATCCATCGTCGGAGCAGCACCTCATGGCTAC
GTGGCACATCCACCGACTCCGTCTGGTGACCGCAGCAGTGTGGACTGGGAAACCTTCACACGCATCGCGTACAACTATCATGCAGCGCACGCAAGCCAGG
GATTCCCGACGGCCTCACAGCCTCAGCACACGGCAACGACGTCAACGCCAGCGGCTGGTGGCTCATCCGTGCCTCCTGCCACAGGACTCAAACGATCCCG
ATCGAAAACTCGGTCGCCGTCTAAAGCCTCGACGACATCGGCGTCCACCACGACTGCCCCAGTCGTTGGTGTGGCGGCTGTCGACTTCTCCAACAACCCC
GAAGCCGTCGTGCGCCACATGAGCTACATGGTGTCACAGATCCGTGATGACTTGCTGCAGCATATCATCGCCCGTACACTCACGTTCGTGCGAGTGCAGC
CTTCCAACAGGGCTGTAGGCGAGCTGTCCGATGagATTGAGGCGGTGTGCGAGACCATCTTGGGCGACAtCCAACAGAAGCTGGTCGATATCAATGATGC
AGaAGCTGTCACTCAGGGCAAACCGCCTGGTGGTCCACCGTCCGAGACGTCTCACATGTACCGAGTCGAGATCCTCAAGTTCGTGTCCAAGGAGTTGGCT
CGTGCGATGGCCGAGGCAGTGGAGAAACGATTACCGCCTGCGACCAAGAAGTCGCTCAATCGCTCGCTACTCGCACTCATGGTGCAGAAAGCCCAAGCGT
CGCTCGAGAACCAAATGCGCGTCGAGAACGCCAACTCACCAGGAGGAACCAACACTACCAACAACACTAGCAGTAGTACGGGGACCGCGTCAGGTCGTTA
G