Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-1.20
Orientation:
(-)
Number of Exons:
3
Description :
Phosphatidyl inositol kinase (PIK-A)
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phosphatidylinositol 3-kinase, C2 domain35.227PS51547
Phosphoinositide 3-kinase, accessory (PIK) domain23.836PS51545
Phosphatidylinositol 3-/4-kinase, catalytic domain79.13PS50290
HmmSmart predictionP-Valprediction_id
Phosphatidylinositol 3-kinase, C2 domain8.1SM00142
Phosphoinositide 3-kinase, accessory (PIK) domain9.4SM00145
Phosphatidylinositol 3-/4-kinase, catalytic domain2.8SM00146
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Phosphoinositide 3-kinase, accessory (PIK) domainIPR001263
Phosphatidylinositol 3-kinase, C2 domainIPR002420
Y-scoreD-scoreY-pos
0.4970.56329
InsideOutsideTMhelix
38-57
102-112
230-235
296-321
1-14
81-83
136-206
259-272
345-1432
15-37
58-80
84-101
113-135
207-229
236-258
273-295
322-344
*** None ***
PositionContextScore
650RIGRIRR|GV0.627
*** None ***
GO
Biological ProcessGO IDPrediction Method
phosphotransferase activity, alcohol group as acceptorGO:0016773IEA
KO ID
K00914
K00914
K00914
K00914
K00914
*** None ***
Sequence
        4744 bases(100 bases per row)
ATGGGGGATGGCAGCGGCGCGATGCTGCGCTACCCACCGCTGTGGCTGCGCACTGCGTCCATGCAGGTGCTCGTGGTGTCCGCGATCTTCTTCTGCTGCC
CTGGTGTCTTCAACACCTTCTCATCCATCGCCAGCGGGCTCCAAGACCCGACGATTGCGTTCCGCGGCAACATGTTCATCTACGTCTTCTTCACGGTCTC
AAGCATCGTGGCCGCCGCACTCATGGCATCAGTCGGTATTCGCCGCGCATTCGTCGTGGGCTCGCTGGGCTACGTTTTATATGCCGCGTCGCTGTGGAAT
CTGTCGACAAAGAGCGAGGCGCCGTCGACCATGACATTGGGCATCTTCTACGTGGCCAGTGCTGCCCTCGGCATCTCGGCCGGTTTCCTCTGGATAGCTC
ACGGCCAAGTGATCATGAGCTACGCTACGGaGGAAAACCAGGGGCAGTATCTTAGCCGCTTCTGGGTCATCTTTAACCTCGGTGCGACgGGCGGGGGCAT
CATGACATGCCTACTCAATTGGAGTTCGATCGACACAGCGACACACCAAGTATCACAGGCATCGGATACGACGTTCCTCGCATTCGTCGCCCTTACAGTC
ACTGGCTTGTGCATTGCAGCGACATGCATCGTCTCGACTGAGTCGGTGGTCAAAGAGGACGGCACCAACGTAGCATCTACTGCATCCAGTCGAGACACTC
AGCAATGGCGTATCCAGGCGAAACGGTTGCTTCGATATCTCGACAGCAGTCATCAGATCTTGCTGCTGTTCCCGTTCTTCATGTACAGCAACTGGTTCTA
CACCTACCACTCGTTCTTCAACGTCGCCACGTTCAATCTGCGCACTGGAGGATTAGCGAGCGCTTGCTACTGGACGGCTCAGATGGTCGCCGCGCATTGG
CTTGGCTCGTTCTTGGACTCGAATGCATCGGCCGGTCTATTCGCTCAACGGCGCGTTGCATGGATTGTGATCCTCGGACTCGCGATCGTGTGGAACCTCA
TGTGGGCCTGGGGATGGTACGCTCAAGACCAGTCCCTCCGGCTGTCGTACGACACACCGCTCGCCCTCGACATCCTCAACGACACTCGTGCTGCGTTGGC
GCCACTTGCACTCTACATACTGTACGGCGCGGGCGATGCACTTGGTCaAGTGTGGATCTACTGGTACTTGAGCTCGGTGTGTTCCAACGGGaAgAGCCTC
GAGGTCGCTGGCTTCAATGCTGGGCTCTACAAGTCCGTCCAGGCGCTCAGCGCTGCTGTCTCTTGGTACATTGGCTCGCAACGCGTGTCTCCATCGTCCC
AGCTTCTCGTCAATTGGGTGCTGAGCAACGTGGCGCTGCTCGGTGCGATGCTGTCGCTGCGCACTCGCCACAACCCATCCAGCAACCCGTTGCTCCAGTC
GTACCTAAGaTAAAACTCTCCTCATCTAACTCTCGATGCACATACCCACACTGTCCGCATGATCCCCCATCATATTCCGCCCCCGTGGCCCGTcCTCCCA
TCGTTGGTGTCGCTTCGTCATCATCAGCTTCTGACTCTTCCTCCTCGGATGTGTAcCCTCTTCTaAGTACGGTTACGTTTCGTTAAGTTCGCACCCTGGC
GTTTCtTCCCGACTCCTTGACTGTAATGCACACTGTGATCGCCTCCGAGCCAAGATGATCGTGCCCAAGATGAAGGAGTATCGCTACTACCTCAGTAGCG
GCGTGAACAAGGGCATCAGCATCAAGATAGCACACTTGGACCTCGCGCCGcCCGCGAGCGTgGGCGGAGAcCCGCTGCAGACGCCCCTGGGCGGCCCATA
CTCGATCATGGAGCCACGCAGTCCGCCGTcCCGCATgGGGGCGTCTGCCTCTGCTGCTGGCCATcGCTTCAGTGCGTTCGATGCaCCAGCATTAGAGCAA
CGTGCTGGCTCATCGTCGTCGGAGCTGCGCAACGCCACCAtcAACGAGATCTTCGTgACGGCGCAGATCTTCTCCGATGGACTGCCATTGCATGCCATGG
TCATCAGtTCCAAGGGCCCGACCAAGTGCAGTGAGTCGACGATCTACTGGAACGAGTGGATGTCGTTCCCCGTCAAGTACCGAGATCTATCGCGCAACTC
GCAGCTTGCCATCACGGTGTACGGCGTCGGGTGGAAGCCCATTGGCGGCACGACGGTCCGGTTGTTCACCAAGCAGGGCGTCCTGCGTGACGGTCTGCAG
TGTCTACGCATATGGAAGGATGTAGAAGCTGATCCGTCGCCCATGACGTCGACGCCGAGTGACATGGGCAAGGACTGGCCTGGGCACGAGTGTTTCCGCC
TTGATAAACTCCGAGAGAAGAAAGAACGGGATGAGATCCCGAGGAACGAGTGGATGGACGGGATGACGGACCGTCGTATCGGCCGCATCCGTCGTGGTGT
CGAGCCGCCGAGTCGCAAGGACGCACTCGGTCCATTTGGTGCGTACCGTGAAGACCCCATTCTCTGGATTGAGCTGCCGTACTTTGGAGACGTCGTCGTG
TATGAGGAAGAACCATATTCGCAGCGCAATATCCACACATCGATGTACTCGAAAGAGATGAAAGCGACTGCAGGTGCGGCGACGCCAAGTGCTGCCAACG
GTGCGATGACGACCCCCGTGCCTGGTAGCGGTGGTCTGCCGGCACTGTCCGCTCCCTCGATCTACGGCGGGGATCCGTACGCGATCTACGATAGCGGAGG
CTCGAAGGAACCAAGCGATCGGCCTCCAGCCAACCTCATGCTAGTGTGGGACCCGGATCTCAACGAAGAGAATCCGTCAGAGAGGAAGTACCGAAAGCTT
GCGCGTGATATTCTACGAGGCTCGATCGATCCGAACCTCAAGCCGAGTCGTGACGAGAAGGCCCGCATCGAGtTTTTACTGGCGACACTGACGGACAACC
TGAAGAACGAAGACAAGGACCTGCTGTGGAAATTCCGATACACGCTGACGGACAACAAGAAGGCTGTGGTCAAGTTCTTGCTCTCGGTGGACTGGAATGA
CGAAACAGAAGTCAAGCAGGCCACCGAACTGCTGAACCAGTGGTGTGAGATCGACATCGCTGACGCACTCAAACTGCTGGGTCGTGATAAGGAGTTCAAG
CACGAAATGGTGCGGAACTTTGCCGTGTCGACGCTGGCACGGGCCAAGAACGAAGAGCTTCAGGACTACTTGCTGCAGCTCGTCCAGGCTCTGCGTTACG
AGAAGCCGAAGCTCGTCGCCAACACTGGCACGTGGCGTGGAACGCCTACTGATGATGCCAGCAGCACGGACGGAGCGATCGCAAACGAATCCCTCGGTCC
ATTGGCGCGCTTCCTCATTGAGCGATCAGGTGCGAGCTTCCAAATGGCCAACTTCTTCTTCTGGTACTTGAAGGTCGAGTCGACAAACTTCAGCAAGGAC
AGTGACATCTTCCGCACGGTGTTGAACGCGATGCTCGATGAAATGAAGCAGGACCAGGAGAAGAAGCCGATTTACGACATGCTCATGGCACAGAAAGATC
TCATGGAACGAGTGCTGTCGATTCACAACAAGGCCCGTGAGGAGCGCGGTCGCAAGGACCaAAAAGAAGAGAAATTTCGACAGCTACTCAAGCAGTTCCC
ATGGCAACGGGGCGTCGTCATTCGCATGCCGCTGGACCCGACAGTGCATCTGAGTGGGATGATCCCGTCCTCAGCCCTCATGTTCAAGAGTGCGATGTAC
CCTGCCGTCGTCGAGTTCCAGACTGTGACGCCCGTTGAGCACCACCACCATGGACACCACCATCACCATGGACACGTCGGCAGTCTGTCAGCGTCTCAAG
CGGGCAGCAATTCGATGTTGTTGCGTGGTTCAAATGACTCCATTTTAGAGAACGGTCTTGGCCAGTCAGCGCATCCCCCTGCGATCTCTGAGTCGGCGCT
ACTGCGAGAGTCGTTGTCAACGCGTGTGATTCACTATCTAAACCGCGAGAAGGAAGGCCCAAcTTACAAGGTCATGGTCAAAAACGGaGACGATCTACGT
CAGGACCAGCTCATCATGCAGATGTTCATTCTTATGGACCGCCTACTCAAGCGGGTTAACTTGGACCTTAAGCTCAcCCCGTACCGGATCCTGGCgACTG
GTGCAAGTGACGGTCTGATGGaGTTCGTCCAAGGATCTGTGGCCGTCGGAAAGATCGTGAGCTCGTACGAGTCGCCTCAGATTTTGACGTTCCTTCGAAA
ACaCAACCCAGACCCAAGGGCAGAGTTCGGGGTgGCGcCCGAGGCCTTGGACACGTACGTCAAGTCTCTTGCTGGCTACTGTGTGTTGACGTACATTCTT
GGAATCGGTGATCGTCACTTGGACAATGTCATGATGAAGCCCCAAGGTCATCTGTTCCATATTGAtTTTGGTTTCATTTTTGGTGCGGACCCCAAGCCAC
TACCTCCGCCGTTCAAGCTCACGAAGGAAATGGTCGAAGGCATGGGTGGTCCCGAGAGTGAACACTACAAGAAATTCAAGCGCTACAGCTGTCAAGCGTA
CAACTGGCTCCGaAAAAGTGCCGATTTGATTCTCAACCTGCTTAGTCTCATGGCCGATGGAGGTATCGAAGAGCTTTCGAACGATCCAGAAACTACGCTG
CAAAAGGTGCAAGAGAAATTCCGCCTCGATCTCTCCGATGAACAGGCCGAGCAGTTCTTCCTTGGACTCATCAACGACAGTGTCTCGGCGTTTTTcCCCG
TGCTTGTCGAGTACATTCACAAGCTCGCGACTCGACTCAAGTAA