Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-0.49
Orientation:
(-)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1313
*** None ***
PositionContextScore
154DPERYRR|SL0.684
1058WKSRPKK|YV0.615
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3942 bases(100 bases per row)
ATGCTGTCGACGGGCGTGGCGGTGCGGAAATGCACTTGTCTCGTGGACACCGAGTCTGACTCTGAAGACGAAGCGGCCCCAGCACTCGCGCTGATCCCGA
ATGACGCTCAAGACGCAGAGATGCGCGACGTCGCGAGCGATGCCGCCGCCATGGGGCCAACTAGCCTGCGCCGTAAAGTGTCTGGGTACCGCGATCCGAT
CTCCACTTCCACTGCGCTACACAACTCAGAAGCGCTGCGGCAGGCGCATGTGCTGCAGAACATTTTCTGTGCATGCTACGAGGTGGAGACCGTGTTGATG
CAGGTGCAACGCCGTGAGCGGAACTTCTCGCCCATGCAAGTGACGCTACTCAAGCAAGAGAGCATCGCGACTGTGTTCCGCTATGCAACATCGACAGCAG
CGAGCGATCGTCGAGGTTCACTCGAACaATCATCGGTTCACGACCCAGAGCGGTATCGTCGAAGCCTTGTAGCCACGGAGATCATCATCAAGTTCTACAT
GAAGGCAATGGCATGGCATGGTAACCCGAAGCCAGTGAGTGCACCACCATCTCCGAAAAACAATGGAGGTGATAAATCACCAAAGTCGTCGCCATCGTCT
TCAAAAATGATGTTCTCACCGCCTAGCAGTCCAAGCCAGCAGCGACGACGATATAGCGTGGACTCGGTAACTCCGACGTCTCCCTCACACCGGCAAATTT
TGTCGTTCGGTGCAACTTACAAATCCAAGAGTGCTGCCGGCAGGAAAAAGAATCCGTTCGGGCATAGCCATAGCACCAGTACCTGTAGCCTGCAAGATGT
AGCCACAGGTGTGAACCTGAACGGTCTCGATGCTTTCGACTCCCCAGAAATACGCGGCTACATTATTCGTCTCGAAGATCTGACAGAGAACGAGTGGAAA
TCAATATTCAGCCAGTTGtTTAAtTTtTTGTGGGAGTTTTCGGAGAGCGGTGATGCTCATGGGACCCGTGTCGGCAGCAACGGAATGCATGCTATATCAG
AGAAGAGCACCACGAATGGCGTTACGGCTTCTGAAATGGAACCAGTCGACAGTATCTTGGTTGCAAACATGTGCAAGATTACGAAGCACTTCAtTGtTTA
TCCTTCTGTGCATAAGTTATTGGCAAACATTGAATGTcCCGGCCCGCACGTTGATGGAGTCGCTACATTTACAACTCTGTTTCCTGCGCTTGCAGCGTTC
GCATACTCGTCAGACATTGCAACATTGATCCACGGTGTCATTCATATTGCTCAGCGGCGTCAATACGAATTGGATGGGATGGTTCAGAGCCTTGTGTATC
AGTTGACGTCCCCCACGATCACCGGGGGTCGTACCGGTTTGATCGCTGGTGGTTCCAACAATATTTTCAATCTCAAAAAGCCGTTGCATTACCACGAAAC
TATCAGCAATTGCGCAGAGATTCTCGTCAAGATCCTCACACAGCAATTCCCCAACACCTTTCGGTATTACATTCACACAAAAATCCAACTGGCATCGTTC
GAAAGTGTCGAACCATTCGAACGTGAACTTTTTCCTCCAAGATTTCCCCCAAGCGACCCTTCATTGCATGCTGATATCAAAAATGCGGTCATGAGTGCTA
TTCTGGAGGATCCGGTAGCAATTGATCGAATAGCTGAAGTGTCGCTGGCGGAACTCCGATTCCTCGACGCCTATCAAGCGTCATTATCTGGAATTCCAGG
AACTCTAGTCGTTGATGTTATCCGGTCTGCTATTGAGTGTTCACTGCATGATCGGGCTCAACTGGAGCTGTTCATACCCAGTGTGAATCGAATCAGTGAA
GTGTTCTGCGCGGCAATTAACTTTCATCAGCATTTGACAACGATATCCGAGTTTGCATCCCGAGATTGTTTCAGTGACAGTGATTCAGACGATGACTCGA
CTAATCTTGATGATGATCACGCGGAAGACGATGACGATGGAGAGCCCACAGGCTTCGACTCGGATCACGATTCGCCTGCTGCCAAGCTTCCAACACCGCG
TGTAATATCGATTGCGGACGATGTCGTAACGAGACCGAAGAAAGATAGCCTTACATCAACCGTGACTTCGAGCAGCTCGTCATCGGTATGCTTTTCGCCT
ACATCCGGGCGACCTGTCATCAATCATCGCCCCCTGACGTCGATTGAGCTCATCACGCATATTGTGGATTTTTTTGATGTTGTTATCCGTATgGGGAATG
ATGGCATCGACAATCGACTTACTCGATTGGATCTCTCGACCTCACTGATTCAACTCTTTGAAAAGTTTTCTACAGCTAATATTCTTCACTGCAGACTCCT
GAAGCTAtTTCTTAACCTTCTCGACAGAAATACCAGTGGCCGAATCAACAATCCGTTTCtACGTAGCGTGTTCCGACCGCCGAATTCTATTCAAGaATTC
ATCaAAAAGaAGTTGaACAAAAGTGCGAAGACTcACCCGTATGATCCACATCTATCAATCCTTGGAGTGAAGATAGACAAGATATGCAGTGCtCCCTCAT
TGCAGCAGGAACTAATCCGGCAATACTGTACAGCAACTGCTGGGTGGTCCGAATTTGCGTCAACTCTTGTTGCTCGCCATTATCAACAGATGGATGCTCT
GGATGATCTGGCTCTTGCCCTTGGATCGAATGGAAACAATGGTGGAGGGCTCCTCGGAAGACGAAGCACAGGTATTGACGGAATCGAGGATGTATTTCCC
CTTGGGCGGATATCTTCATCATCGTGTGATTATCTTTCTGGCGAATTACAACCATTTCGACGGTTACCAATGGaAAAAGAAGGATTTGGTTCTTCACAAA
ACCTCGCGTCTGGAGCAGATGCAGTTCATCCAACAGACATGCTTAAGAGTCGAGCTCAAAGTCAGTTCCCACAATCAATCATTGATATACTCCGGAACGA
TACATCAACTTCGTTTGATGCAGACGAAGATGATGCATCTCTCTCAGGCTTCGTGTACCAGAAGCTTGCAAAATGGGTGAAGGTGCAGTTGAAATTCGAC
AAGTCGTCATGCGTCCTGATATGCCAGGAAGTTCACTCAGCGTCGACTTCTTCCAGCAACAACGGGGCGACATCTGCCACTTCTCCTCCAACGAAGAAAT
CGTCATCATCCACATCTAAATGGAAACAGTTATGGAATCAACACAAAATGCAGTGGAAGAGTCGCCCCAAGAAGTACGTCGTTTGCATGGCACGGAAGTG
GATTGCGTTTGGTCGCAGTGTCAAGAAcCCGAATGTTGGTGCCTTTGGGTTTCAAATTGACGTCTTCGATCGCATTCGCGAAGAAGACATTACGTTGACG
TTTGTGACTCGGTCAGAGCAAACTCGGACATTATGGCTGGATACGCTACAAACATCAGTTTTTGGAACGCGCACCATGCGCCAACGAAGCATATCAGACG
GTGACGAGGAAGCGAGTATAATGCTTGTGAAGTGTGTCGCCACTCAGCGTGAGGGTAGCCAAATCGTCTATTTAGCAGTGCCAGATGTTCATGTGCTTGG
GCCAGTCATCGCATCAAGTTTCTCTCTGAAGTCAGAAGTACCAGAAGAGATCCCTTTCTGGGGTACTTTTCAAGGGGCGCATGGAGTTAGCAAATACTGC
TCACTGTTCAGGCGATGCCTTCACGTCGTATCTGTTCAAGAGAAACGCATCTACGCAAGTGGATATTCTGTCATCGTTGAATTCGATGCAACACTTCAAG
CCATTGAGACGGATGCACCTGCGACACCCGTTGTGCGCAAACCTGGTGGGTCTGGTCGTCTCCACCTCCAATTGCAGCTTGCCCCTCCGCCAAACCCAGA
GAAGACAGTGACGTGCTCGTTCACGGATACGTATTTGGTCAGCGGAAACCAAATCGTCTCGATGACAAGAACCATCGCAGACTCAGAAAAGCTCGTCAAG
GTTCTGTGTGATGATCCATCCGAGTTAGAAGGATGCACCTAA