Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-1.5
Orientation:
(+)
Number of Exons:
1
Description :
RRNA 2'-O-methyltransferase fibrillarin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Fibrillarin8.9PR00052
Fibrillarin8.9PR00052
Fibrillarin8.9PR00052
Fibrillarin8.9PR00052
Fibrillarin8.9PR00052
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-178
*** None ***
PositionContextScore
55FSHRSGR|DL0.555
*** None ***
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
methyltransferase activityGO:0008168IEA
tRNA processingGO:0008033IEA
rRNA processingGO:0006364IEA
*** None ***
*** None ***
Sequence
        537 bases(100 bases per row)
ATCGCCGCTGCTATCCTCGGTGGTGTCGACAACATCTGGATCACCCCTGGCTCCAAGGTGCTGTACCTCGGTGGTGCCTCGGGTACTACCGTGTCGCACG
TCTCGGACATCGTCGGACCAAGTGGCGCTGTGTACGCCGTCGAGTTCTCGCACCGTTCCGGTCGTGACCTTATCAACGTCGCCAAGTCGCGAACCAACAT
CATCCcAATCATTGAAGACGCTCGTCACCCGCTCAAGTACCGCATGCTCGTGCCAATGGTCGACACGGTTTTCGCCGATGTGGCGCAGCCTGACCAGGCT
CGTATTGTTGCATTGAACGCTAGTTACTTCTTGAAGAACGGCGGTCACTTCGTCATTTCCATCAAGGCGAGTTGTATCGATTCTACTGCACCTGCTGAGG
CGGTCTTcGCCCGTGAAGTGAAAAaGTTGCAGCAAGAACAGTTCAAACCAGCCGAGCAACTCACCCTGGAGCCGTACGAACGTGACCACGCCGTGGTTGT
TGGATCCTACCGTGCCCCCAAGAAGGACAAGAAGTAA