Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.14
Orientation:
(-)
Number of Exons:
2
Description :
Cysteine protease family C01A
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase C1A, papain C-terminal4.9PR01217
Peptidase C1A, papain C-terminal4.9PR01217
Peptidase C1A, papain C-terminal4.9PR01217
Peptidase C1A, papain C-terminal4.9PR01217
Peptidase C1A, papain C-terminal4.9PR01217
*** None ***
HmmSmart predictionP-Valprediction_id
Peptidase C1A, papain C-terminal3.6SM00645
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6630.78820
InsideOutsideTMhelix
1-564
NN-scoreoddsWeighted Score
0.5231.1290.002
PositionContextScore
545GYVRLQR|ST0.564
TypeScore
extracellular, including cell wall444
GO
Biological ProcessGO IDPrediction Method
cysteine-type peptidase activityGO:0008234IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        1878 bases(100 bases per row)
ATGCACCGCCCCTCGACCCTTATGATCGCCCTTGCGGCTACGGCCGTCGCCCTGGCCGTGGATGCCCGTCCAATGCACGCAGGCATTGACTACGCGCGCT
ATCTCAAGGAGAAGGACACGGTTGCCGATGAGCTCGACGCCTGGATGAACAAGTACCAGGACGATGCTGAGGCCAATGGTTGGCTTCCACAGACAGAAGC
GCGTAGTGCTGACGAGATTCAGGAAGAcCGCaAACAGCGCTTCTTCATGGCCAAGGAGCTGGTCAAGAAGCTAAAGGAGAAGAACCCAGATGCCGAGTTC
TCGACAGACTCGCCCTTCACGCTCATGACAGAGGAAGAGTTTGCCAAGTATGTCCGTAACTCATACGTGAGTGGCGCTACAACGCGCCGACTGCGTCAGG
ATGTAGAGCGCAACCGTGTGCTGACCCAGGCCCAGAGTGACGCTGACGAAGGCAATGCTAAGGTGCGCACCATGGATCTCAGCCAGTTCTTCTCGAGCAT
TTTTAAGAAGAACAACGGCGACGCGGTCGCGAGTGAGAGCTTCGACTTCAAGGGAGCCCTCGAAGATCTGCAGAAGGTCGACTGGCTGATGGTCTTCGGC
TGGAAGAAGAACCCAAACAAGGATCAGCCGTCCCCAGCTTCTGAGACCCCAGCTCCTGAGACTCCAGCTCCTGAAACTGCGGCCCCAGAGACCTCTGCTC
CTGAAACTCCGGCTCCTGAGACGCCGGCCCCATCCGAGGCTCAGACGGATGCTCCAGCGTCAGCTGATGAGCCAGCATCCAACGAAGATGCCGAGGTCGA
TGTGACCCCAGAGACTGATGCTCCAACACCAGAGGATGAGATCAATACCGATGGTGATGATACAGCCGATGAAACGGAGGTTTCTACTCCAGCTCCCGAG
CCAGAGACGGAGGCGCCTACACCCGcCCCTGAACCAGAGACCGTGGCCCCGAcTCCAGCTCCTGAGCCAGaAACGGaAGCTCCTGAGCCAGaAAcGGAAG
CTCCTGAGCCAGaAACGGAAGCTCCTGAGCCAGAAACGGAAGCTCCTGAGCCAGAGACCGAAGCGCCTGAGCCAGAGACCGAgGCGCCAGAGCCAGaAAC
GGagGCTcCTGTCCCAGCTCCAGAGCCAGAGACTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCCAACGGAGTTGACTGGTCAACCAGCGCTTGCATGCCTCCTATCCAGAACCAGG
GTCAATGTGGCTCCTGCTGGTCGTTTGCGACTATTGCCGCTATCGAAACCACTAAGTGCATCAAGAAGGGTGGTGCGGTCCAGAAGCTCTCGGAACAGAA
CCTGGCTGCTTGCAGCTCGCGCAACTACGGCTGCAATGGCGGAGTGCCTGTGTGGGGTATGCAGTACATCATGGTGAACGGTGTCTGCACAGAGCAAGAC
GACCCATACACTGCTACCAACGGTCAGCTAGGTGGATGCAACACCGGTTGCAACAAGGTGAACCCAGGCATGAAGGAAATCGGCCGTGTTGAGGATGAGC
CTGGGCTGATTGACGCGCTCAAGGGTCAGCCACTTGTTGTCGCTGTTGCTTCAGGCAACAACGCTTTCAAGCAGTACAAGGGCGGTGTGCTTTCGTACTG
CGAGTCGACGCAAGTGGATCACGCTGTGCTTCTTGTTGGATACGACGACAAGACACTCAAGATCCGCAACTCCTGGGGAACGTCGTGGGGCGAGCAGGGC
TACGTGCGTCTCCAACGCTCCACCTCCGGCAAGGGTACATGCAGTGTGCTCACGGATATGACGTACGTCAAGTTTTAG