Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-snap-gene-1.51
Orientation:
(-)
Number of Exons:
2
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-91
NN-scoreoddsWeighted Score
0.7092.6220.005
PositionContextScore
83FRRRQKR|LS0.66
TypeScore
nuclear478
GO
*** None ***
*** None ***
*** None ***
Sequence
        344 bases(100 bases per row)
ATGCTGAGCCGCGTGATCCCGACGGCTGCGCGTGCGGCGTTCGCGCCATGGACGGCGACTGCGGCTGCTGGTGCGTGATCCGAAAGGTTCTGTGCGTCCC
TCATCCGACTGACTGTGTCTCTGCGTCTCTCTGTGCAGTGCGCCGCCCTGCCGCGCCCTTGAACCTCGTGGATGCGTTCGCGCAcCTGCGTGtGGTCGAT
GAGCCACTGGCCAcCAAcTCGATCATCATGGAGTGCCtCAACCGCAACGCGCGTCGCCCGAAGAAGGCCAAcCACGGCAAGcGCCCGTGCTCCAACTTCA
GAAGACGGCAGAAGCGTCTGAGCCGACGAAACGCCGCCAAGTAG