Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.21
Orientation:
(-)
Number of Exons:
2
Description :
Aspartate carbamoyltransferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Aspartate carbamoyltransferase7.4PR00101
Aspartate/ornithine carbamoyltransferase6.3PR00100
Aspartate carbamoyltransferase7.4PR00101
Aspartate carbamoyltransferase7.4PR00101
Aspartate/ornithine carbamoyltransferase6.3PR00100
Aspartate carbamoyltransferase7.4PR00101
Aspartate/ornithine carbamoyltransferase6.3PR00100
Aspartate carbamoyltransferase7.4PR00101
Aspartate/ornithine carbamoyltransferase6.3PR00100
Aspartate carbamoyltransferase7.4PR00101
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-323
NN-scoreoddsWeighted Score
0.61.6230.003
*** None ***
TypeScore
cytoplasmic609
GO
Biological ProcessGO IDPrediction Method
amino acid bindingGO:0016597IEA
carboxyl- or carbamoyltransferase activityGO:0016743IEA
cellular amino acid metabolic processGO:0006520IEA
'de novo' pyrimidine nucleobase biosynthetic processGO:0006207IEA
KO ID
K00609
K00609
*** None ***
Sequence
        1036 bases(100 bases per row)
ATGGCGACGACCACGAGTGTGCTGGATGCCAAGCCCGGCAAGGGCCAGTgGGAGGGACAGGACATCCTGTCGACAGAGCAGTTCGGCGTCGAGAGCGCCA
AGCGCGTGTTGCGCGTGGCCGATGAGATGAAGGCAATCGTCAAGAGCAGCGGGAGCACGGACCTGCTCAAGGGCAAGGTGCGCCATCCCCAGGATGCGTG
CGCATGTAGGACGGACGGGCTGATGACACGTGTGTCTGCAGCTGCTCGCCAACATCTTCTACGAGCCGTCGACGCGTACGAGCTGCTCGTTCCAGTCGGC
GATGCTGCGTCTTGGCGGCCTCGTCGTGTCGGTCAATGAGAGTTCGTCGAGCGTCAAGAAGGGTGAGACGTTGTCCGACACCATCCGCTGCATGGCCAGC
TACTCGGACGTGATTGTGCTGCGTCACCCGGTCAAGGGTACGGCGGCGATCGCTGCTGCTGCGACCTCCAAGCCCGTGCTTAACGCCGGTGACGGTGTCG
GTGAGCACCCGACGCAGGCGCTGCTGGACCTGTACACGATCTACAGTGAGCTTGGTACCGTTGATCTGCAGGGCAAGGTCGTGACGATGGTGGGTGATCT
CAAGAACGGACGCACGGTGCACTCGCTGTCGCGTCTGTTGGCCCTCTTCGGCGCGTCAGTCAACTACGTcGCCCCCGAGAGTCTCAGGATGCCGCGTTAC
ATCTACGACGAGCTCGCCGCAAAGGGCGTCAAGCAACACGAGACAAGTGATCTCGAGTCAGTGATTGCTCAGAGTGATGTGCTGTACGTCACGCGTGTGC
AGAAGGAGCGCTTCGAGTCGGAGGCCGAATACGACGCCGTCAAGGACAGCTTCATCATTACGATGGCCACGCTTGCCAAGGCCAAGTCGAACCTCGTCAT
CATGCACCCGCTGCCACGAGTGGGTGAGATCGCCGAGGAAGTGGACAATGACCCTCGCGCCGCGTACTTCCGCCAGATGGAGAATGGCATGTACGTGCGT
ATGGCATTGCTTGCACTGGTACTCGGCAAGGCTTAA