Transcript Name :
Pytap_DAOMBR444maker-pag1_scaffold_1-fgenesh-gene-0.10
Orientation:
(+)
Number of Exons:
5
Description :
Serine racemase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-396
*** None ***
PositionContextScore
19DEERVRR|NV0.585
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1449 bases(100 bases per row)
ATGCGCGAGTGGATGGTGACCCCGAGCGTTGCGCTGGACGAGGAACGCGTGCGCCGCAACGTGCAGCACATGCAGCAGATCGCGCACACGCACAACGTCG
CACTCCGACCCCATGTCAAGACGCACAAAaCCGTGGAAATAGCCACGCTCCAGCTGCGTGAGGGCGCATGCGGAATCACGGTGTCCAAGCCGTCAGAGGC
GCTCAAGTTCATTCACAGCGGCATCAAGGAGCTCAAGAGTGTGCTGCTCGCGTACCCGGTCGTGCAGATCGCCAAGGTCACCAAGCTGTTGATGGCGGCG
CAGCAGTTCGGCATCGACTTCCGGCTGACGGTCGACTCGGTACACGGTCTCGACGCTGTTGAGAAGGCCGCCGTGTCGTGCGACTTTGTGCCcAAGATTC
TGCTTCATATTgaCGTCGGTTACCACCGTGTTGGTCTCGAGGAGGGGGATCCGCGCATCGTCGAGTTTGCAACGCGCATCCACAACTCCAAACACCTCGA
GTTTCAAGGAATCCTCTCGCACGCTGGTGTGTCCAGAGTGATTCTGAGGGAAACACAGTATGAAGACTGACAAGAACTGTGCGAATGTTGATCTCCAGGT
CACGCGTACTCGTGCACGACGGTGGAGCAATGTGCAGAGATTGCAGAGACTGAACGCTTGATCATGGTGCGCATTAAGCAGTCGATCGAAGCGGTGTGTG
TGGTGTCCAAGTGGGGTGAGCTAATAAAAACGGCGAACTGACACTGTGATCTCGCTTAGAGTGTTGTCCCAGTCGCGACGGTCTCGTGCGGAAGCACGCT
CACAGAGCTAGCACGCAAGGACTTCAGTGGTATCACCGAGGTATATGCAAGCAGAATCGCGTGAAATGTtGGGGTTTGATCAATCtCTTTTGTCCGCAGA
TTCGCCCTGGAAACTACGTCTTCCTGGACCGCACGCCAATCCGCATTGGCTTGGCCACGATTCGTGACGTGTCTCTCACAGTTCTCGTCACCGTTGTGAG
CTCCAACAAGCACTATTTCATCGTAGACTCCGGTTCCAAAGTGCTGAGCTCGGACATGTAAGTCAGGATGACTAGACATCACCGTCTAGCGCTAATTTAT
ACCATCATAAAAAAACAGGCCACGAAGCGGATCTCCGGATGAGTTTGGCTCGCAATGCTATGGCTTGGCGGTTCTTGAGAAGGACTTTGGTCTTCTCGAG
AAAGAGCCAACAGCGCACAAGTGGATCACGCATGAGGGCAAGCCTGTGGCGGTGTGGGAGGTCAAGAAGCTCTCTGAGGAACACGGTTGGCTCAAGCAGG
TGgAAGGCACCGAGCTACCGCCGATTGGCTCGCGCATGATTATCATGCCCAACCACTCATGTGTCGTGGCCAACCTCACGGACAACTTGTACGTGCAGGG
ATCACAGGCCAAGATTTGGACCACCATCTCGCGTGGCTGCACGCAATAG